Multiple axes of inter-organ signaling regulate 
organ scaling 
 
 
A Dissertation 
SUBMITTED TO THE FACULTY OF 
UNIVERSITY OF MINNESOTA 
BY 
 
 
AMBUJ UPADHYAY 
 
 
 
 
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS 
FOR THE DEGREE OF 
DOCTOR OF PHILOSOPHY 
 
 
 
 
 
Advisor 
MICHAEL B. O’CONNOR 
 
 
 
August 2019 
  
  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
© Ambuj Upadhyay 2019 
 
  i 
Acknowledgements 
 
First and foremost, I would like to thank Michael O’Connor for allowing me 
to conduct my graduate work in his lab. I am forever indebted for to him for being 
an incredible mentor and a friend. His patience has allowed me to craft my own 
project, and develop my own ideas which has been the best training anyone 
could ask for.  
I would like to also thank the past and present members of the O’Connor 
lab for their support in and especially out of the lab. Going to work was never a 
chore because of the friendly and engaging atmosphere that they all created. 
Their selflessness and eagerness to collaborate was an essential aspect of 
producing this body of work. In particular I would like to thank Aidan Peterson, 
Mary-Jane O’Connor, Myung-Jun Kim, and Lindsay Moss-Taylor for their 
contributions to this work. 
Thank my committee members: Jeff Simon, Thomas Neufeld, Jim Ervasti, 
Jeongsik Yong, and Laura Gammill. Thank you for the support, criticisms, and 
scientific guidance throughout my graduate training.  
This work was funded in part by the Ray Anderson Fellowship from the 
GCD department, and NIH grants. 
 A very special thank you to my friends in the graduate program. Especially 
the MCSB class of 2012. I came to Minnesota knowing nobody, and in a matter 
of 2 weeks at Itasca, I made some lifelong friends. Our social fabric is what kept 
me going year after year, and without you this work would not be possible. 
 Lastly, I would like to thank my family for always supporting my career 
goals and encouraging me no matter how uncertain the paths are. As they say, If 
I have seen further, it is by standing on the shoulder of giants. Without you all, I 
would not be able to achieve this accomplishment.  
  ii 
Dedication 
 
 
This dissertation is dedicated to my parents 
Urmila Upadhyay 
& 
Sankat Haran Upadhyay  
  iii 
Abstract 
The mechanisms governing static allometry of organ size has long been 
enigmatic. A central hypothesis predicts that during animal growth, body size is 
perceived by organs via inter-organ signals, which directs organ growth to match 
body size. Ligands of the Transforming Growth Factor β (TGFβ) superfamily are 
prime candidates for mediating this coordination of organ-body size. In 
Drosophila, multiple ligands of the Activin-like subfamily (Myoglianin, Activin-β, 
and Dawdle) signal via the only type-I receptor Baboon (Babo). Similar to defects 
in insulin signaling, null mutants of babo result in small imaginal discs and small 
overall body size. This is in part due to metabolic defects caused by defects in 
Daw signaling. In this dissertation I report how Activin-β and Myoglianin regulate 
body size and organ growth respectively. In Chapter one, I review known 
mechanisms governing growth in Drosophila. In Chapter two, I show that Activin-
β signaling via Babo in the muscles is required for muscle growth and proper 
body size, but not imaginal disc growth. Remarkably, it is the motoneurons in the 
central brain secretes Activin-β necessary for body size.  In Chapter three, I show 
that Myoglianin regulates imaginal disc growth which express specific 
combination of receptors that make the cells sensitive to only one ligand. 
Additionally, it is the larval muscles secrete Myoglianin which regulates imaginal 
disc growth but not body size. In chapter four, I speculate as to how such inter-
organ signaling mechanisms can ensure proper allometry within species, and 
suggest additional experiments that would test this emerging model. 
  iv 
Table of Contents 
ACKNOWLEDGEMENTS ..................................................................................... I 
DEDICATION ....................................................................................................... II 
ABSTRACT ......................................................................................................... III 
TABLE OF CONTENTS ...................................................................................... IV 
LIST OF FIGURES ............................................................................................. VII 
CHAPTER I .......................................................................................................... 1 
INTRODUCTION .................................................................................................. 1 
1.1 INTER-ORGAN COMMUNICATION....................................................................... 2 
1.2 ALLOMETRY .................................................................................................. 4 
1.3 DROSOPHILA MELANOGASTER AS A MODEL FOR STUDYING GROWTH ................... 7 
1.4 DROSOPHILA LIFE CYCLE ................................................................................ 7 
1.5 SYSTEMIC REGULATORS OF BODY SIZE IN DROSOPHILA ..................................... 9 
1.5.1 Insulin/IGF-1 signaling .................................................................................................... 9 
1.5.2 TOR signaling ............................................................................................................... 10 
1.5.3 Ecdysone and Juvenile Hormone regulate growth ...................................................... 12 
1.6 SIGNALING PATHWAYS REGULATING ORGAN GROWTH...................................... 14 
1.6.1 Ras/Raf/MAPK signaling pathway ............................................................................... 14 
1.6.2 JNK signaling ............................................................................................................... 16 
1.6.3 Hippo signaling ............................................................................................................. 17 
1.6.4 Other signaling pathways ............................................................................................. 18 
1.7 TGF Β - SUPERFAMILY.................................................................................. 19 
1.7.1 Core Drosophila TGF-β Family Signaling Components ............................................... 20 
1.7.2 TGF-β family signaling in the wing imaginal disc ......................................................... 24 
1.7.3 Models of Dpp gradient formation in the wing disc ...................................................... 25 
1.7.4 Modifiers of the Dpp gradient ....................................................................................... 27 
1.7.5 Transcriptional responses to BMP signaling in the wing disc ...................................... 28 
1.7.6 Role of Dpp in regulating tissue growth ....................................................................... 30 
1.7.7 BMP signaling in pupal wing development ................................................................... 32 
  v 
1.7.8 Mad is a focal point for integration of cross-pathway signals ....................................... 33 
1.7.9 BMP signaling in other imaginal discs .......................................................................... 35 
1.7.10 TGF-β family signaling in the nervous system ........................................................... 38 
1.7.11 Activin signaling stimulates neuroblast proliferation .................................................. 43 
1.7.12 Activin signaling and axon guidance and target selection ......................................... 44 
1.7.13 Activin signaling and neuronal remodeling................................................................. 46 
1.7.14 Role of TGF-β family signaling in physiological and metabolic homeostasis ............ 48 
1.7.15 TGF-β family signaling in metabolic homeostasis ...................................................... 49 
1.7.16 TGF-β family signaling regulates hormonal control of Drosophila development. ...... 54 
1.8 STATEMENT OF THESIS WORK ....................................................................... 56 
CHAPTER I FIGURES .................................................................................... 57 
CHAPTER II ....................................................................................................... 64 
MOTONEURON-DERIVED ACTIVINΒ REGULATES DROSOPHILA BODY 
SIZE AND TISSUE-SCALING DURING LARVAL GROWTH AND ADULT 
DEVELOPMENT ................................................................................................ 64 
SUMMARY ......................................................................................................... 65 
INTRODUCTION .................................................................................................. 66 
RESULTS .......................................................................................................... 71 
Actβ is required for adult viability, normal body size, and correct tissue scaling .................. 71 
Actβ disproportionately affects larval muscle and certain polyploid tissue sizes .................. 73 
Actβ mutants feed normally but grow slowly ......................................................................... 74 
Overexpression of Actβ in its normal pattern produces larger and slower-growing larvae. .. 77 
Tissue and cell-type specific rescue experiments identify several potential sources of Actβ 
for controlling body size. ........................................................................................................ 78 
Motoneuron-derived Actβ regulates body size and viability .................................................. 80 
Motoneuron derived Actβ signals through the canonical Babo/dSmad2 pathway to control 
muscle and body size. ........................................................................................................... 83 
DISCUSSION ...................................................................................................... 85 
Localized versus systemic effects of Actβ ............................................................................. 85 
Mechanisms of Actβ control of tissue size ............................................................................ 88 
Larval versus Adult requirements for Actβ ............................................................................ 89 
Body-appendage scaling ....................................................................................................... 91 
  vi 
TGFβ control of body size in other animals ........................................................................... 94 
MATERIALS AND METHODS ................................................................................. 96 
CHAPTER II FIGURES ................................................................................. 103 
CHAPTER III .................................................................................................... 121 
MUSCLE-DERIVED MYOGLIANIN REGULATES IMAGINAL DISC GROWTH
 ......................................................................................................................... 121 
SUMMARY ....................................................................................................... 122 
INTRODUCTION .......................................................................................... 123 
RESULTS ..................................................................................................... 127 
Myoglianin is required for proper discs growth .................................................................... 127 
Myo signals canonically via dSmad2 .................................................................................. 130 
Myo signaling in imaginal discs requires a specific isoform of Baboon .............................. 131 
Babo-a, Punt, and Plum mediate non-canonical signaling in wing imaginal discs ............. 133 
Muscle derived myoglianin signals to the wing disc ............................................................ 136 
Overexpression of Myo in muscle or fat body rescues myo mutant disc growth ................ 138 
DISCUSSION ................................................................................................ 139 
Only Myo regulates imaginal disc size ................................................................................ 140 
Plum and Punt are required for efficient Babo-A signaling to dSmad2 in the wing disc ..... 141 
Intrinsic (intra-organ) vs extrinsic (inter-organ) mode of Myo signaling .............................. 143 
Significance of inter-organ communication ......................................................................... 144 
MATERIALS AND METHODS ............................................................................... 146 
CHAPTER III FIGURES ................................................................................ 150 
CHAPTER IV .................................................................................................... 165 
CONCLUDING REMARKS & FUTURE DIRECTIONS .................................... 165 
Brief summary ..................................................................................................................... 166 
Significance of brain - muscle and muscle - wing communication ...................................... 166 
Future directions .................................................................................................................. 169 
REFRENCES ................................................................................................... 171 
 
  vii 
List of Figures 
FIGURE 1-1. STATIC ALLOMETRY OF ORGAN SIZE WITHIN AND AMONG SPECIES. ...................58 
FIGURE 1-2. LIMB XENOGRAFT EXPERIMENTS BY TWITTY AND SCHWIND. ............................59 
FIGURE 1-3. CORE TRANSFORMING GROWTH FACTOR Β (TGF-Β) FAMILY SIGNALING 
COMPONENTS IN DROSOPHILA. .................................................................................60 
FIGURE 1-4. TGFΒ FAMILY ACCESSORY FACTORS IN DROSOPHILA .....................................61 
FIGURE 1-5. DPP SIGNALING IN DROSOPHILA WING DEVELOPMENT. ....................................62 
FIGURE 1-6. BMP AND ACTIVIN SIGNALING AT THE NEUROMUSCULAR JUNCTION .................63 
FIGURE 2-1. ACTΒ NULL MUTANTS EXHIBIT A SMALL BODY SIZE AND LATE PUPAL LETHALITY.
 ............................................................................................................................ 103 
FIGURE 2-2. ACTΒ MUTANT ADULT ESCAPERS HAVE A DISPROPORTIONATELY SMALLER 
ABDOMEN COMPARED TO HEAD, THORAX, LEG, OR WING. ......................................... 104 
FIGURE 2-3. ACTΒ DISPROPORTIONATELY AFFECTS THE SIZE OF LARVAL BODY WALL MUSCLES 
AND FAT BODY NUCLEI SIZE. ................................................................................... 105 
FIGURE 2-4. ACTΒ MUTANT LARVAE GROW SLOWLY BUT DO NOT EXHIBIT DIFFERENCES IN 
CRITICAL WEIGHT OR DEVELOPMENTAL TIMING. ...................................................... 106 
FIGURE 2-5. ACTΒ OVEREXPRESSION INCREASES BODY SIZE AND DELAYS DEVELOPMENTAL 
TIMING. ................................................................................................................. 108 
FIGURE 2-6. ANALYSIS OF ACTΒ-GAL4 DRIVER EXPRESSION PATTERN (GREEN) IN L3 LARVAE.
 ............................................................................................................................ 109 
FIGURE 2-7. EXPRESSION OF ACTΒ FROM SPECIFIC CELL TYPES DIFFERENTIALLY RESCUES 
ACTΒ MUTANT PHENOTYPES. .................................................................................. 112 
FIGURE 2-8. MOTOR NEURON DERIVED ACTΒ SIGNALING THROUGH BABO AND DSMAD2 
CONTROLS BODY SIZE. ........................................................................................... 113 
FIGURE 2-9 ACTΒ DOES NOT AFFECT MUSCLE NUCLEI NUMBER ........................................ 114 
FIGURE 2-10 SIZE OF VARIOUS POLYPLOID NUCLEI IN ACTΒ MUTANTS. .............................. 115 
FIGURE 2-11 RNA IN SITU HYBRIDIZATION OF ACTΒ SHOWS EXPRESSION IN VARIOUS TISSUES
 ............................................................................................................................ 116 
FIGURE 2-12 OVEREXPRESSION OF ACTΒ IN MOTONEURONS OR NEUROENDOCRINE CELLS 
INCREASES ADULT BODY SIZE. ................................................................................ 117 
  viii 
FIGURE 2-13 HYPERACTIVATION OF ACTIVIN SIGNALING IN MUSCLES BUT NOT FATBODY IS 
LARVAL LETHAL ..................................................................................................... 118 
FIGURE 2-14 OK372-GAL4 IS NOT EXPRESSED IN DIMM+ NEUROENDOCRINE CELLS .......... 119 
FIGURE 2-15 MUSCLE SPECIFIC ACTIVATION OF ACTIVIN SIGNALING INCREASES BODY SIZE 
BUT NOT WING SIZE ................................................................................................ 120 
FIGURE 3-1. MYOGLIANIN REGULATES SIZE OF IMAGINAL DISCS BY AND ACTIVATES DSMAD2.
 ............................................................................................................................ 151 
FIGURE 3-2. BABOON-A REGULATES WING DISC GROWTH................................................. 153 
FIGURE 3-3. BABO-A AND PUNT ARE REQUIRED FOR NON-CANONICAL SILENCING OF BRK. . 155 
FIGURE 3-4. MUSCLE DERIVED MYO IS REQUIRED FOR NON-CANONICAL BABO ACTIVATION IN 
IMAGINAL DISCS. .................................................................................................... 157 
FIGURE 3-5. OVEREXPRESSION OF MYO IN MUSCLES AND FAT-BODY RESCUES WING DISC SIZE 
OF MYO MUTANTS. ................................................................................................. 158 
FIGURE 3-6. MYO MUTANTS SHOW NO DEFECTS IN CELL DEATH OR CELL GROWTH. ............ 159 
FIGURE 3-7 QPCR ANALYSIS OF BABO ISOFORM EXPRESSION IN LARVAL TISSUES ............. 160 
FIGURE 3-8. RNAI FOR BABO-A RESCUES WING DISC OVERGROWTH DUE TO DSMAD2 RNAI.
 ............................................................................................................................ 162 
FIGURE 3-9. PLUM IS REQUIRED FOR NON-CANONICAL BABO ACTIVITY. ............................. 163 
FIGURE 3-10. MUSCLE OVEREXPRESSION OF MYO INCREASES WING SIZE ......................... 164 
FIGURE 4-1. MODEL OF WING/MUSCLE SCALING VIA MYO SIGNALING ................................ 170 
 
 
 
  1 
 
 
 
 
 
 
 
 
 
 
Chapter I  
 
Introduction 
 
 
 
 
 
 
 
 
Section 1.7 of this introduction is modified from a previously published work in 
which several co-authors contributed equally (Upadhyay et al., 2017) © Cold 
Springs Harbor Laboratory Press. In particular Arpan C. Ghosh generated figure 
1-3 and 1-4. Myung-Jun Kim generated figure 1-6. I generated figure 1-5. 
  
  2 
1.1 INTER-ORGAN COMMUNICATION 
Early in evolution life evolved from a heterogeneous soup of chemical 
reactions into a more specialized compartmentalization of cellular function known 
as organelles. Subsequent evolution of multicellularity, specialized cells, tissues, 
and organs has given rise to complex lifeforms we know today. Communication 
between every level of this hierarchy (from organelles to organs) is essential for 
the survival of the organism. Certain forms of communication like intra-cellular 
signaling are ubiquitous. For example, virtually in every cell adenosine 
triphosphate and adenosine diphosphate (ATP/ADP) levels signal to 
phosphofrucktokinase to regulate glycolysis and energy homeostasis. 
Communication between cells and organs are just as important. Organs have 
acquired specialized tasks and coordination among them are necessary for 
proper function as a whole.  
Depending on the context, mechanisms for inter-organ communication 
can vary dramatically from small molecules, and proteins to even mechanical 
forces. One of the most obvious types of inter-organ communication involves the 
nervous systems and muscles. Motoneurons signal to the skeletal muscles via 
the neuromuscular junction to induce muscle contraction. When a wave of 
chemical potential from the neuron cell body reaches the axon terminal, small 
synaptic vesicles containing neurotransmitters such as acetylcholine are 
released by the neurons into the junction which are taken up by the muscles 
  3 
triggering contraction (Kuo and Ehrlich, 2015). In humans, some muscles lining 
the internal vital organs can also signal back to the brain via the vagus nerve 
(Chambers et al., 2013). Among the many different inputs into the vagus nerve, 
stretching of smooth muscles in the stomach walls stimulates the nerve which is 
thought to trigger satiety (Williams et al., 2016; Zagorodnyuk et al., 2001). 
Another common type of inter-organ communication occurs via protein ligands. 
Probably the most widely recognized protein ligand involved in inter-organ 
communication is Insulin. In humans, nutrient uptake causes a spike in 
circulating sugar levels which then induces Insulin secretion from the pancreas 
(Quianzon and Cheikh, 2012). Circulating insulin triggers sugar uptake in most 
tissues, but also has other roles in different peripheral tissues (Quianzon and 
Cheikh, 2012; Rosenfeld, 2002). Defects in insulin signaling leads to numerous 
physiological complications collectively known as metabolic syndrome (Eckel et 
al., 2005).    
The examples above highlight how different organs are linked in order to 
maintain energy homeostasis. Such mechanisms are widely conserved because 
they provide the basic building blocks for organisms to grow and maximize 
fitness (Nylin and Gotthard, 1998). Accompanying overall growth, is the growth of 
individual organs. During animal development, different organs are specified at 
different stages and grow at different rates (Penzo-Méndez and Stanger, 2015). 
This raises the question of how growth among different organs coordinated. Is 
organ growth controlled passively by regulating nutrient uptake then differential 
  4 
processing in peripheral tissues? Or do organs communicate their size status 
with one another to regulate growth? As with most biological questions, the 
answer could possibly be both. Even though we know at great detail how 
regulation of nutrient metabolism affects organ growth, it remains less clear 
whether different organs in the body directly communicate to regulate each 
other’s growth.  
 
1.2 ALLOMETRY 
When discussing inter-organ coordination of growth, the term allometry 
comes to mind (Huxley, 1932). In the broadest sense, allometry refers to the 
scaling relationship between a specific trait/parameter (e.g. metabolic rate or 
organ size) to body size (Garland and Carter, 1994; Gould, 1966; Schmidt-
Nielsen, 1984; Spence, 2009). In this manuscript, allometry will generally refer to 
the scaling of organs to body size. Allometric relationships can be characterized 
in three different ways: ontogenetic allometry refers to the variation in organ size 
through development of an individual, static allometry refers to variations in organ 
to body size among individuals in a population, and phylogenetic allometry refers 
to variation across multiple species and/or taxa (Frankino et al., 2009; Stern and 
Emlen, 1999). With regard to organ/body size, it is well known that within species 
animals tend to have a stereotypic ratio of organ to body size, i.e. static 
allometry. However, allometry varies significantly among taxa, phylogenetic 
  5 
allometry (Frankino et al., 2009; Spence, 2009). This has been one of the 
greatest mysteries in evolutionary developmental biology; how does limited 
variability within species coincide with high variability across taxa? To 
comprehend this idea, two fundamental questions must be investigated. First, 
what is the mechanism of morphological allometry among individuals within a 
specie and second, how does it evolve?  
The first step to asking the larger question of evolution of allometry is 
determining the how organs scale with body size within a specie. Static 
morphological allometry can be assessed by measuring variation of organ/body 
size in the wild population (genetic allometry), or in the laboratory by altering 
environmental inputs such as temperature and nutrition (environmental allometry) 
(Frankino et al., 2009). Such quantitative measurements can be summarized by 
the equation y = bxa, where x represents body size, y represents the size of a 
specific body part, and a rep resents the allometric coefficient (Frankino et al., 
2009; Huxley, 1932). Log transformation of the data results in a linear 
relationship between organ and body size where a is the slope of the regression 
line (Figure 1-1 A) (Frankino et al., 2009). Comparing the static allometry of 
related species can sometimes reveal different coefficients for each group 
(Figure 1-1 B,C) (Frankino et al., 2009; Gould, 1966; Spence, 2009).  
Identifying the allometric coefficient for different groups doesn’t really 
identify the underlying mechanism governing allometry. That requires 
experimentation to test the system. Before the modern day genetic and 
  6 
molecular techniques, in the early 20th century Twitty and Schwind made one of 
the seminal findings in the field using tissue grafting experiments in salamanders 
(Twitty and Schwind, 1931). Since perturbing overall body size independent of 
other body parts is challenging, the reverse was the only feasible experiment, 
and luckily some salamanders are highly amenable to grafting body parts. They 
obtained two salamanders, Amblystoma punctatum and Amblystoma trigrinum, 
which develop to significantly different body size that have proportionally sized 
limbs. Then they grafted a limb primordium from the large salamander onto the 
body of the small animal, and vice versa. Surprisingly, they found that the grafted 
limbs grew to match the size of the donor animal not the host (Figure 1-2) (Twitty 
and Schwind, 1931). In essence they had disrupted the allometric relationship of 
the limb size to overall body. But more importantly, their experiments along with 
numerous others from different animal models suggests that the final organ size 
is largely determined by tissue intrinsic factors (Bryant and Simpson, 1984). 
Thus, the body provides permissive signals for growth, such as nutrition and 
hormones, and the organs provide their own growth signals to determine the final 
organ size.  
Modern day research aims to identify the molecular players that regulate 
overall body size as well as organ size. How these mechanisms affect growth 
locally and systemically in the animal will shed light on how static allometry is 
attained. Furthermore, phylogenetic analysis of the molecular players may help 
answer the larger question of how allometry evolves to give rise to the diversity 
  7 
we see today. To help answer some of these questions we need a powerful 
animal model system. Below I will discuss the Drosophila melanogaster model 
and our current understanding of how body and organ size is regulated in this 
system. 
 
1.3 DROSOPHILA MELANOGASTER AS A MODEL FOR 
STUDYING GROWTH 
Drosophila melanogaster, commonly known as the fruit fly or vinegar fly, 
was established as model organism over a century ago by Thomas Hunt Morgan 
lab at Columbia University. Initially used to study heredity, today the portfolio of 
research using D. melanogaster is vast, and has claimed 8 Nobel Prizes as of 
2018. Many of the disease associated genes in Humans have orthologs in 
Drosophila, making them a great model system to study molecular function 
(Chien et al., 2002). Furthermore, the use of an extensive and powerful genetic 
toolkit allows researchers to rapidly test hypothesis and identify the associated 
molecular mechanism. 
 
1.4 DROSOPHILA LIFE CYCLE 
D. melanogaster are a part of the order Diptera, and are holomatabolous 
insects that undergo complete metamorphosis via a pupal stage, as opposed to 
  8 
hemimatabolous meaning incomplete metamorphosis. Adults sexually reproduce, 
and after mating females begin to lay eggs. At 25 degree Celsius egg 
development takes ~24 hours followed by three larval instar stages which lasts a 
total of four days and are demarcated by cuticle molting events between each 
stage. During the larval period larvae grows approximately 200 fold, the bulk of 
which occurs during the third instar stage lasting 48 hours (Church and 
Robertson, 1966). At the end of the larval stage the animal stops growing and 
forms a pupae to begin metamorphosis. During the 4-5 day pupal stage, many of 
the larval tissues undergo histolysis and new adult structures are formed from 19 
imaginal discs that developed during the larval stage (Hales et al., 2015). The 
term imaginal comes from the Latin word imago meaning image which refers to 
the adult fly stage, and they are called disc because they resemble a flat round 
structure (Aldaz and Escudero, 2010). After the adults emerge from the pupal 
case, they mature and are reproductively active within several hours to complete 
the life cycle. Important to note that although the adults feed during their lifetime, 
they do not grow in either length or mass. This makes the larval growth period 
incredibly important for accumulating as much energy/mass as possible in order 
to survive the non-feeding pupal stage as well as maximizing reproductive 
fitness.  
 
  9 
1.5 SYSTEMIC REGULATORS OF BODY SIZE IN DROSOPHILA 
As mentioned above, growth occurs only during the larval stages, both in 
terms of the overall body size and also for the individual organs like the imaginal 
discs. Below I will briefly discuss what is known about how overall body size is 
regulated. 
1.5.1 Insulin/IGF-1 signaling  
The major regulator of growth in Drosophila is the Insulin/Insulin-like 
Growth Factor (IGF) signaling (IIS) pathway. In vertebrates insulin mediates 
metabolic functions and the IGF signaling promotes cell and tissue growth 
(Nakae et al., 2001). However, in Drosophila the two pathways are not distinct 
because they use the same ligands and receptors and mediate both metabolic 
and growth functions (Boulan et al., 2015). Upon feeding, in Drosophila free 
sugar in the hemolymph stimulates secretion of Insulin-like peptides (Dilps) from 
the Insulin producing cells (IPCs) in the brain (Colombani et al., 2003). 
Circulating Dilps travel to peripheral tissues and bind to Insulin receptor (InR), 
which then activates phosphoinositide-3-kinase (PI3K) (Boulan et al., 2015). 
PI3K activation leads to Akt activation which then regulates a host of different 
pathways, mainly Ras/Raf/Mapk, FOXO, and TOR pathways, all of which 
converge to regulate growth at transcription and translation levels (Boulan et al., 
2015; Gokhale and Shingleton, 2015; Teleman, 2009). In Drosophila mutations 
that inhibit IIS, such as Dilp, InR, and chico knockouts, results in dramatically 
  10 
smaller animals (Böhni et al., 1999; Grönke et al., 2010). Conversely ectopic 
activation of the pathway, such as Dilp overexpression, results in larger animals 
(Ikeya et al., 2002). Tissue specific perturbation of IIS signaling by FOXO 
expression leads to differential growth of the organs, which explains why different 
organs are more or less sensitive to external inputs like nutrition (Tang et al., 
2011). Important to note that perturbing IIS pathway ubiquitously, such as whole 
animal mutants, affects both the overall body size as well as individual organ 
size, like the wing, in the same direction (Gokhale and Shingleton, 2015; Ikeya et 
al., 2002). This suggests that in the absence of Insuling signaling, static allometry 
is preserved. Therefore, even though IIS pathway is important for growth, it does 
not regulate static allometry of organ size (Mirth and Shingleton, 2012). 
 
1.5.2 TOR signaling 
Similar to IIS pathway, nutrient uptake provides the initial input to activate 
Target of Rapamycin (TOR) signaling which is conserved from yeast to mammals 
(Boulan et al., 2015). TOR gets its name from loss of function mutants that are 
resistant to the growth suppressing properties of Rapamycin, an anticancer drug 
(Heitman et al., 1991; Sabatini, 2017). Upon feeding and digestion, free amino 
acids in the hemolymph are taken up the peripheral tissues and activate TOR 
signaling (Boulan et al., 2015; Wolfson and Sabatini, 2017). TOR exists in two 
different complex, TORC1 and TORC2, however TORC1 is the primary regulator 
  11 
of nutrient dependent growth (Boulan et al., 2015; Wolfson and Sabatini, 2017). 
TORC1 activity is requires Rheb, mutants of which are significantly smaller 
(Saucedo et al., 2003; Stocker et al., 2003). Recently, several amino acid 
molecular sensors have been identified in mammalian cell culture models that 
activate TORC1 (Wolfson and Sabatini, 2017). These include arginine sensors 
SLC38A9 and CASTOR1 that localize to lysosomes and cytosol respectively, 
and leucine sensor Sestrin2 that is also cytosolic (Chantranupong et al., 2016; 
Wang et al., 2015; Wolfson et al., 2016; Wyant et al., 2017). In Drosophila, only 
Sestrin2 is available to detect amino acids (Wolfson and Sabatini, 2017). In 
addition to amino acids, TORC1 activity can also be regulated by AKT signaling 
(see section 1.5.1 above). AKT activity inhibits TSC1/2, which in turn inhibits 
Rheb activity (Boulan et al., 2015; Wolfson and Sabatini, 2017). Ultimately 
TORC1 regulates growth by activating S6 Kinase (S6K) and inhibiting 4E-BP 
which promotes protein synthesis (Boulan et al., 2015).  Therefore under normal 
conditions nutrient uptake by the larvae results in both IIS pathway activation as 
a result of free sugars and TOR pathway activation as a result of free amino 
acids, both of which converge to positively regulate tissue growth and overall all 
size. 
 
  12 
1.5.3 Ecdysone and Juvenile Hormone regulate growth 
Developmental checkpoints and timing of metamorphosis are critical 
aspects of insect biology which are regulated by the steroid hormone Ecdysone 
and a sesquiterpenoid Juvenile Hormone (JH) (Rewitz et al., 2013). Both of these 
hormones are synthesized in the Ring gland, but by different sub-compartments. 
Ecdysone is synthesized by the Prothoracic gland and JH by the corpus allatum 
(Rewitz et al., 2013). Ecdysone is the master regulator of developmental 
checkpoints in insects.  
Ecdysone is secreted in pulses during the larval growth period that 
induces molting transitions between larval instar stage as well as the induction of 
pupal stage metamorphosis the end of larval growth (Riddiford, 1993). The 
process of molting is essential for growth, because it allows the larvae to shed its 
constrictive outer cuticle. The ecdysone peak at the end of third instar is also 
important, because it marks the end of the growth period (Rewitz et al., 2013). 
Multiple inputs regulate ecdysone production in the PG. The main effectors of 
ecdysone production and secretion are IIS (see section 1.5.1), TOR (see section 
1.5.2), and Prothoracicotophic hormone (PTTH) signaling pathways (see reviews 
(Boulan et al., 2015; Rewitz et al., 2013). PTTH is a peptide ligand that is 
produced in a discrete set of neurons in the brain which synapses onto the PG 
cells (Gilbert, 2004; McBrayer et al., 2007). In the PG, PTTH activates MAPK 
pathway via its receptor Torso (Rewitz et al., 2009). Loss of function mutants of 
PTTH, Torso, Ras/MAPK, or genetically ablating the PTTH neurons result in 
  13 
larger animals because of a failure to produce ecdysone at the correct time, 
hence the larvae continues to feed and grow (Caldwell et al., 2005; McBrayer et 
al., 2007; Rewitz et al., 2009; Shimell et al., 2018). 
PG secreted ecdysone acts systemically via the hemolymph and regulates 
target gene expression in peripheral tissues (King-Jones and Thummel, 2005). 
Once Ecdysone is taken up by peripheral tissues, it is converted to its active 
version 20-hydroxyecdysone (20E) which then binds to cytosolic Ecdysone 
Receptor (EcR) and Ultraspiracle (Usp), and regulates transcription of target 
genes (Thomas et al., 1993; Uyehara and McKay, 2019; Yao et al., 1993). 
Interestingly, ecdysone signaling in different tissues results in drastically different 
outcomes. Ecdysone signaling in imaginal discs promotes growth and 
differentiation by repressing 4E-BP (see 1.5.2) and derepressing patterning 
genes such as wg (Herboso et al., 2015; Mirth et al., 2009). Additionally, 
ecdysone signaling results in lower levels of systemic IIS, which is rescued by 
EcR knockdown specifically in the fat-body (Boulan et al., 2015). It turns out the 
basal levels of ecdysone inhibits Myc activity which then affects Dilp expression 
and secretion from the IPCs through an unknown mechanism (Delanoue et al., 
2010).  
JH signaling plays a minor role in regulating growth. JH is expressed 
throughout larval development and is rapidly destroyed before the onset of 
pupariation (Browder et al., 2001; Riddiford et al., 2010). The role of JH in 
Drosophila is unclear however, in other model systems it is thought to be 
  14 
required for Ecdysone production and secretion (Browder et al., 2001). In 
Drosophila neither ablation of the corpus allatum or exogenous JH is able to alter 
the timing of Ecdysone dependent puparium formation (Nijhout et al., 2014; 
Riddiford et al., 2010). However, JH depleted animals do have a slower growth 
rate and are smaller (Riddiford et al., 2010). In summary fine tuning of ecdysone 
and JH signaling throughout larval development not only affects organ growth 
directly but also body size by regulating systemic insulin signaling and 
developmental checkpoints. 
 
1.6 SIGNALING PATHWAYS REGULATING ORGAN GROWTH  
The previous sections highlight systemic factors circulating in the 
hemolymph which affect growth globally. In the following sections, I will discuss 
tissue intrinsic factors and signaling pathways that are crucial for regulating 
organ growth. 
 
1.6.1 Ras/Raf/MAPK signaling pathway 
Throughout wing imaginal disc development, multiple growth factors signal 
in the wing imaginal disc which converge onto the Ras/Raf/MAPK signaling 
pathway. These include EGF, FGF, and to a lesser extent Dilps (see section 
1.5.1) which activate their respective receptor tyrosine kinases on the plasma 
  15 
membrane. Ligand activation ultimately leads to the activation of the small G-
protein Ras. GTP bound Ras activates Raf kinase and which activates MEK1/2 
which then activates MAPK. Activated MAPK then translocates to the nucleus 
where it phosphorylates several transcription factors which regulate expression 
of hundreds of genes. For a detailed review of the Ras/Raf/MAPK signaling 
pathway, see reviews (Keshet and Seger, 2010; Sopko and Perrimon, 2013).  
Ras/Raf/MAPK signaling regulates growth in multiple larval tissues. 
Overexpression of activated Ras in wing disc cell leads to cell autonomous myc 
activation and together they upregulate the cell cycle regulator cyclinE which 
induces G1/S transition and cell growth (Prober and Edgar, 2000). Consequently 
this ectopic Ras activation also leads to non-autonomous cell death of 
neighboring cells, probably due to lack of myc in the dying cells (Karim and 
Rubin, 1998). EGF signaling in the disc may also regulate growth by helping in 
patterning dorso-ventral boundary which positions the expression of an important 
morphogen wingless (Zecca and Struhl, 2002). Furthermore, two rounds of EGF 
secreted from the visceral muscles of the larval midgut is required to attain the 
proper number of intestinal stem cells, first during the early larval stages and 
second to induce production of adult midgut progenitors (Jiang and Edgar, 2009). 
In virtually every Drosophila tissue that has been analyzed Ras/Raf/MAPK 
signaling pathway is the focal point for the cross-talk between Insulin signaling 
and receptor tyrosine kinase pathway. Feedback from AKT as well as myc further 
complicates how a cell responds to Ras activity (Keshet and Seger, 2010). In 
  16 
summary although Ras/Raf/MAPK pathway has a clear role in regulating cell and 
tissue growth, it is often challenging to accurately ascribe what percent each of 
the initial signal contributes to the final output.  
 
1.6.2 JNK signaling 
The Jun N-terminal Kinase (JNK) is part of the MAPK signaling family. 
Drosophila genome contains only one JNK called, basket (bsk). After Bsk is 
activated by upstream MAPK, it subsequently activates transcription factors Jun 
and Fos, which then regulates expression of target genes (Pinal et al., 2019). 
The role of JNK signaling in regulating tissue growth has predominantly been 
studied in the wing disc context. Here JNK signaling remarkably can play dual 
roles of inducing apoptosis and proliferation of “looser cells” and neighboring 
cells respectively (Pinal et al., 2019). Under normal conditions low levels of JNK 
activity along the anterior-posterior axis of the wing disc is thought to be required 
for normal proliferation of cells nearby (Willsey et al., 2016). However, under 
stressful conditions such as tissue damage or irradiation, a pulse of reactive 
oxygen species (ROS) signaling induces JNK activity which is necessary for 
repairing the tissue (Santabárbara-Ruiz et al., 2015). A key step in the process is 
removing the damaged cells, which requires caspase activation. In these dying 
“looser cells” JNK signaling is required for proper activation of caspase mediated 
cell death (Ryoo et al., 2004; Shlevkov and Morata, 2012). Furthermore, similar 
  17 
to EGF/Ras signaling, JNK signaling is also required in the surrounding “winner 
cells” to repair the damaged tissue. In these cells JNK activity upregulates 
mitogenic factors such as wg and dpp which provides the cues for proliferation 
(Ryoo et al., 2004). For a more detail on JNK signaling in the wing disc, see 
review (Pinal et al., 2019). 
 
1.6.3 Hippo signaling 
One of the most striking organ size phenotypes results from perturbing the 
Hippo signaling pathway. Multiple inputs converge on the core kinases in the 
pathway, Hippo (Hpo) and Warts (Wts). Loss of function of hpo or wts in imaginal 
disc clones results in dramatic overgrowth in a cell autonomous manner (Wu et 
al., 2003b).  Activated Hpo phosphorylates Wts, which in turn phosphorylates 
Yorki (Yki), preventing it from localizing to the nucleus and activing target genes. 
Under the Hpo inactive state, dephosphorylated Yki localizes to the nucleus and 
binds to the transcription factor Scalloped (Sd), and upregulates target genes 
such as cyclinE (cell cycle regulator), myc (cell growth), diap1 (apoptosis 
inhibitor), and bantam (aids proliferation) (Halder and Johnson, 2011). Hence, 
overexpression of yki or loss of hpo/wts leads to dramatic overgrowth of the 
tissue. Thus, under wild type conditions, Hippo pathway actually limits 
proliferation and also induces apoptosis when cells overgrow their normal spatial 
boundaries  (Halder and Johnson, 2011; Hariharan, 2015; Oh and Irvine, 2010).  
  18 
How does Hippo signaling activated? Turns out that many of the inputs 
originate at the plasma membrane where transmembrane proteins ensure proper 
cell-cell contacts, which detects the integrity of an epithelial tissue (Halder and 
Johnson, 2011; Hariharan, 2015). Upon disruption of the cell-cell contacts, 
transmembrane proteins Fat and Crumbs and the basolateral complex of 
Scribble/Lethal giant larvae/Disc large is unable to activate Hpo/Wts which leads 
to Yki mediated cell proliferation (Halder and Johnson, 2011). Furthermore, it has 
been suggested that mechanical forces that cells exert on each other during 
tissue growth regulate Hippo signaling (Rauskolb et al., 2014). Surprisingly, as 
the wing imaginal disc grows, cells experience lower levels of tension which 
negatively affects Hpo (Rauskolb et al., 2014). Thus, as the imaginal disc 
approaches its final size at the end of larval development, low tension turns off 
Hippo signaling and halts tissue growth.  
 
1.6.4 Other signaling pathways 
Several other signaling pathways also play a role in regulating growth, 
albeit in very specific contexts. The Janus kinase (JAK) and signal transducer 
and activators of transcription (STAT) pathway acts generally like a stress sensor 
in hematopoietic cells as well the eye. In the wing disc, JAK/STAT signaling is 
required for proliferation and fate specification during early larval development 
however, later in development it acts predominantly to JNK signaling to sense 
  19 
apoptotic cells (Recasens-Alvarez et al., 2017). For more details see review 
(Arbouzova and Zeidler, 2006). 
Wingless (Wg) signaling is another pathway that plays an important role in 
regulating organ growth. The fascination with Wg is due to the vertebrate 
ortholog Wnt, mutants of which has been known to drive cancers. Wg in 
drosophila is important for fate specification both in embryos and in the imaginal 
discs (Swarup and Verheyen, 2012). Certain wg null mutants fail to specify the 
wing pouch portion of the imaginal disc, which gives rise to adults with only the 
notum portion of the thorax (Morata and Lawrence, 1977; Sharma and Chopra, 
1976). Furthermore, ectopic wg expression in the notum of the imaginal wing disc 
result in the formation of a secondary wing (Ng et al., 1996). For more details see 
review (Swarup and Verheyen, 2012). 
Two additional signaling pathways that regulate organ growth in 
Drosophila are worth mentioning. They belong to the Transforming Growth 
Factor β (TGF-β) superfamily, which includes the Bone Morphogenetic Protein 
(BMP) subfamily and the TGF/Activin subfamily. Since they are the central focus 
of this dissertation, they are discussed in detail below. 
 
1.7 TGF β - SUPERFAMILY 
The TGF-β family signaling pathway is conserved and ubiquitous in 
animals. In Drosophila, fewer representatives of each signaling component are 
  20 
present compared to vertebrates, simplifying mechanistic study of the pathway.  
Although there are fewer family members, the TGF-β family pathway still 
regulates multiple and diverse functions in Drosophila.  
 
1.7.1 Core Drosophila TGF-β Family Signaling Components 
As in mammals, the Drosophila TGF-β family signaling pathway has two 
branches, activins and bone morphogenetic proteins (BMP), initiated by different 
ligands, that are defined by sequence conservation within families and the 
downstream signal transduction components that they use (Figure 1-3).  In both 
branches, canonical signaling begins upon extracellular ligand binding to a 
heteromeric receptor complex composed of two molecules each of type I and 
type II transmembrane serine/threonine kinases. Formation of this ligand-
receptor complex results in phosphorylation of the GS domain within the type I 
receptor by the constitutively active type II receptor kinase.  This phosphorylation 
event activates the type I receptor kinase and enables it to phosphorylate an 
appropriate receptor-activated Smad (R-Smad) substrate, either dSmad2 for the 
activin branch, or Mad for the BMP branch. The phosphorylated R-Smad then 
forms a complex with the Drosophila common-Smad (co-Smad), Medea, and this 
complex translocates to the nucleus where it can regulate transcriptional 
responses with a variety of cofactors.  Some TGF-β signal transduction 
components, such as the type II receptors Punt and Wishful thinking (Wit) and 
  21 
the co-Smad Medea, are shared between the activin and BMP branches and 
often act redundantly, while others, such as the type I receptors and the R-
Smads, are restricted to signaling within a single subfamily branch. Many 
accessory factors interact with core TGF-β components and are discussed below 
(Figure 1-4). 
In the BMP signaling branch, three ligands - Decapentaplegic (Dpp), 
Glass bottom boat (Gbb),  and Screw (Scw) - signal through two type I receptors 
- Thickveins (Tkv) and Saxophone (Sax) - and either of two type II receptors - Wit 
or Punt. Although loss-of-function mutations in either tkv or sax are lethal, tkv 
over-expression can rescue sax mutants (Brummel et al., 1994), suggesting that 
it may be the primary BMP type I receptor, while Sax, in most cases, fine-tunes 
signaling levels. Downstream of the receptors, Mad is the primary R-Smad that 
appears to transduce all BMP signals in combination with the co-Smad Medea. 
One inhibitory Smad, Dad, appears to act specifically to modulate BMP signaling 
(Kamiya et al., 2008). 
Within the activin subfamily, three ligands – Activin-β (Actβ), Dawdle 
(Daw), and Myoglianin (Myo) – signal through the single type I receptor Baboon 
(Babo) and either Wit or Punt, and this branch uses dSmad2 as the R-Smad 
transcriptional transducer. In this pathway, each ligand appears to have unique 
functions, but double mutants have not yet been analyzed in detail to determine 
whether they also act redundantly. Consistent with the unique functional activities 
of the three ligands, three isoforms of Babo have been identified. Each differs in 
  22 
the ligand-binding domain and is produced through alternative splicing of a single 
exon (Jensen et al., 2009). Signaling assays in S2 cells demonstrate that Daw 
signals through BaboC (Jensen et al., 2009), while subsequent in vivo work 
indicates that Myo signals preferentially through BaboA  (Awasaki et al., 2011; 
Zhu et al., 2008). It remains to be shown if Actβ signals through BaboB and if 
there is any promiscuity in ligand binding to the different receptor isoforms. A 
handful of genes have been shown to be expressed downstream of dSmad2 in 
specific contexts (Bai et al., 2013; Gibbens et al., 2011; Zheng et al., 2003) but 
only one, Atg8a, is known to be a direct target, although a fully validated dSmad2 
consensus binding sequence has not yet been determined.  
Unlike in vertebrates, only two non-Smad signaling pathways have been 
described in Drosophila. One involves the activin branch, where Rho-like 
GTPases and Lim kinase act downstream of Babo to limit mushroom body axon 
extension (Ng, 2008) and the other is Lim kinase acting downstream of BMP 
signaling to regulate neuromuscular junction (NMJ) growth (Eaton and Davis, 
2005; Piccioli and Littleton, 2014). 
In addition to non-Smad-dependent signaling, one example of cross-
pathway Smad activation has also been documented in Drosophila (Figure 1-3). 
In this case, the activin receptor Babo can phosphorylate the BMP transducer 
Mad in cell culture and also in vivo when over-expressed together with Mad 
(Gesualdi and Haerry, 2007; Peterson et al., 2012). However, whether this 
occurs under endogenous conditions is unknown. As discussed below, loss of 
  23 
dSmad2 protein does lead to enhanced Mad activity in vivo, but it is not clear 
whether this comes about as a result of enhanced C-terminal phosphorylation of 
Mad or through some other modifications that happen only in the absence of 
dSmad2 (Peterson and O’Connor, 2013). 
As in vertebrates, many accessory factors regulate ligand production and 
availability and several are highlighted in Table 1. For example Drosophila 
follistatin (fs) can modulate ligand activity of both BMP and activin pathway 
ligands; inhibiting Dpp and Actβ while enhancing Daw activity (Bickel et al., 2008; 
Pentek et al., 2009). The BMP heterodimer Dpp-Scw binds to a complex of Short 
gastrulation and Twisted gastrulation (Sog/Tsg) and, as described below, is 
required for shuttling of the Dpp-Scw heterodimer during embryonic dorsal 
patterning (Shimmi et al., 2005). Numerous potential co-receptors have also 
been identified.   
Differential processing can also dramatically affect ligand signal range and 
activity. Furin proteases facilitate maturation of the disulfide-linked ligand dimer 
by processing the inactive pro-protein at any one of several potential “maturation 
sites”.  For Dpp, three furin cleavage sites are processed in distinct ways 
producing ligands with different N-terminal sequences. These alternatively 
processed ligands have different activities, such as long-range or short-range 
diffusion, and variable stabilities (Künnapuu et al., 2009; Sopory et al., 2010). 
They can also affect interactions with extracellular matrix (ECM) proteins, such 
as the Drosophila glypican Division abnormally delayed (Dally), through inclusion 
  24 
or exclusion of heparan sulfate proteoglycan (HSPG) binding sites (Akiyama et 
al., 2008).  In some cases, additional cleavage within the upstream prodomain is 
needed to fully release the prodomain from the mature ligand, and in the two 
Drosophila examples, this processing is performed by a Tolloid/BMP-1 type 
protease (Künnapuu et al., 2014; Serpe and O’Connor, 2006). Lastly, there is an 
example where cleavage of the BMP-type ligand Gbb does not take place at the 
normal maturation site, but instead at an upstream site leading to production of a 
very long mature ligand that, surprisingly, has bioactivity. The choice of 
maturation site seems to be tissue context-specific (Akiyama et al., 2012; Fritsch 
et al., 2012). 
 
1.7.2 TGF-β family signaling in the wing imaginal disc 
Drosophila larvae contain fifteen distinct sac-like tissues called imaginal 
discs, which are mitotic and give rise to adult structures. Here, we will primarily 
focus on the wing imaginal disc because it is the most well characterized system 
for understanding TGF-β signaling. Growth and patterning of imaginal discs is 
largely controlled by Dpp signaling (Hamaratoglu et al., 2014; Restrepo et al., 
2014). In contrast, activin signals play a modest role in cell proliferation but not 
patterning (Brummel et al., 1999; Hevia and de Celis, 2013; Peterson and 
O’Connor, 2013). In the wing disc, as in the embryo, Dpp functions as a 
morphogen to specify different cell fates. In this tissue, Dpp is secreted from a 
  25 
narrow strip of cells abutting the A/P boundary and spreads to both 
compartments, forming a gradient that regulates the expression of several target 
genes in a concentration-dependent manner (Campbell and Tomlinson, 1999; 
Jaźwińska et al., 1999; Lecuit et al., 1996; Minami et al., 1999; Nellen et al., 
1996). The spatially defined expression of Dpp target genes governs both growth 
and size, as well as patterning of the adult wing veins. Below, I will focus on how 
the Dpp gradient is formed, interpreted, and translated to produce a functional 
wing.  
 
1.7.3 Models of Dpp gradient formation in the wing disc 
Francis Crick initially proposed that morphogen gradients can form by 
simple diffusion (Crick, 1970). To examine the role of Dpp diffusion in the wing 
disc, a Dpp-green fluorescent protein (GFP) fusion was created allowing the 
morphogen gradient to be directly visualized (Entchev et al., 2000; Teleman and 
Cohen, 2000). Surprisingly, fluorescent recovery after photobleaching (FRAP) 
experiments using this Dpp-GFP suggested a diffusion coefficient that was too 
slow to account for production of the observed gradient in the wing disc (Kicheva 
and González-Gaitán, 2008). This result led to the development of two alternative 
models, one involving multiple rounds of receptor-mediated ligand uptake and re-
secretion, termed transcytosis (Kicheva and González-Gaitán, 2008), and a 
  26 
second based on directed transport of Dpp along extended actin based filipodia, 
termed cytonemes (Ramírez-Weber and Kornberg, 1999; Roy et al., 2011).  
Although the final resolution of the true mechanism may not be fully 
settled, single molecule imaging of tagged Dpp in the wing disc has allowed for 
measurements of the diffusion coefficient, revealing two distinct populations of 
Dpp that diffuse at different rates (Zhou et al., 2012). A significant portion of Dpp 
diffuses extremely slowly, as predicted for ligand bound to cell surface proteins 
such as receptors, and another pool of Dpp diffuses much more rapidly, 
consistent with free diffusion that is hindered only by the viscosity of the 
extracellular fluid and the tortuosity of intercellular paths (Zhou et al., 2012). 
Theoretical calculations suggest that this highly mobile pool of Dpp is sufficient to 
form the observed gradient in the disc. Furthermore, wild-type cells can sense 
Dpp even when completely surrounded by cells lacking Tkv. This observation 
argues against the need for receptor-mediated transcytosis (Schwank et al., 
2011). To date, no strong support for cytoneme-mediated dispersal of Dpp 
throughout the wing disc has been reported, although it does appear that 
cytonemes convey Dpp from the wing disc to other interacting tissues such as 
the trachea (Roy et al., 2011; Roy et al., 2014).  
 
  27 
1.7.4 Modifiers of the Dpp gradient 
Since the FRAP studies and other microscopy techniques highlighted 
above suggest that most of the Dpp appears to be bound to the cell surface, it is 
likely that any molecule regulating ligand-receptor interactions will dramatically 
affect either gradient formation or the signaling output. Indeed, genetic 
approaches identified the products of the genes division abnormally delayed 
(dally) and dally-like protein (dlp), which encode two members of the HSPG 
family, as proteins that potentially affect Dpp gradient formation and/or signal 
output (Akiyama et al., 2008; Belenkaya et al., 2004; Fujise et al., 2003). 
However, the theoretical calculations now suggest that HSPGs do not restrict the 
fast free diffusion of Dpp (Zhou et al., 2012). Instead, they exert their primary 
effect on signaling output and not gradient formation, likely by facilitating Dpp-
receptor interactions (Kuo et al., 2010).  
Another less well understood aspect of morphogen gradients is their ability 
to scale according to size of the tissue (Wartlick et al., 2011b). A novel secreted 
factor, Pentagone (Pent), has been shown to be important for Dpp gradient 
scaling as the wing disc grows during the larval stages (Hamaratoglu et al., 2011; 
Vuilleumier et al., 2010). Pent contains follistatin-like, thyroglobulin type I and EF 
hand calcium-binding domains and interacts with HSPGs to alter the slope of the 
Dpp signaling output (Vuilleumier et al., 2010). 
  28 
Since pent expression is negatively regulated by Dpp signaling, cells 
along the flanks sense less Dpp as the disc grows in size, and begin to produce 
Pent, which then through feedback, appears to facilitate Dpp gradient expansion 
(Ben-Zvi et al., 2011; Vuilleumier et al., 2010). The ability of Pent to facilitate 
internalization of Dally and Dlp has been proposed to modify the ability of cells to 
trap and transduce BMP by fine-tuning the levels of the BMP reception system at 
the plasma membrane (Norman et al., 2016).  
 
1.7.5 Transcriptional responses to BMP signaling in the wing disc 
The morphogen model predicts that target genes of BMP signaling should 
be differentially expressed within the morphogen gradient field. Indeed, early on 
spalt (sal), optomoter blind (omb), and brinker (brk) were identified as likely BMP-
responsive genes (Figure 1-5, A) that are differentially expressed along the A/P 
axis (Campbell and Tomlinson, 1999; Jaźwińska et al., 1999; Lecuit et al., 1996; 
Minami et al., 1999; Nellen et al., 1996). Both omb and sal encode transcription 
factors that are required for proper patterning and cell survival in the central 
region of the disc, while brk encodes a repressor that is expressed in the lateral 
regions of the disc. brk expression is negatively regulated in the center of the 
disc by silencer elements (SE) that bind a heteromeric complex of transcription 
factors composed of pMad and Medea, together with another transcription factor, 
Schnurri (Affolter and Basler, 2007; Kim et al., 1997). Surprisingly, the induction 
  29 
of omb and sal by Dpp actually occurs by repressing brk, which is itself a 
repressor of omb and sal. The result is that high levels of Dpp signaling directly 
silences brk in the center of the disc so that its expression pattern is an inverse 
complement to that of the Dpp gradient, low in the middle and high at the edges 
(Figure 1-5, A). The graded expression of brk in the more central regions of the 
disc in turn gives rise to the nested expression patterns of omb and sal (Figure 1-
5, A).   
Although expression of omb and sal are indirectly controlled by Dpp 
signaling, direct targets have also been identified, including dad which codes for 
an inhibitory Smad (Tsuneizumi et al., 1997). Dad affects the robustness of the 
Dpp signaling gradient (Ogiso et al., 2011) by blocking Tkv-meditated 
phosphorylation of Mad and oligomerization of pMad (Inoue et al., 1998). Within 
the central region of the disc, dad expression is controlled by an activating 
element (AE) in its regulatory sequences that directly responds to Dpp signals. 
The AE DNA sequence is similar to that of the SE and recruits a trimeric pMad-
Medea complex, but it differs at certain nucleotide positions, such that the AE 
does not recruit Schnurri (Weiss et al., 2010). As a result, it is able to promote 
transcription rather than repress it. The lateral boundary of dad activation is 
controlled by Brk repression. The combined activities of AE and SE elements, 
together with Brk binding sites, appears to explain the bulk of BMP response 
gene expression patterns so far identified in the wing disc.  
 
  30 
1.7.6 Role of Dpp in regulating tissue growth 
In addition to controlling patterning within the wing disc, Dpp also 
regulates tissue growth. Loss of dpp leads to very small discs (Spencer et al., 
1982; Zecca et al., 1995) while gain of Dpp signaling throughout the disc 
produces overgrowth (Martín-Castellanos and Edgar, 2002; Nellen et al., 1996). 
Even expressing extra dpp within its normal source using dpp-Gal4 causes a 
mild enlargement of the larval wing disc with some extra vein defects (Entchev et 
al., 2000; Teleman and Cohen, 2000). When expressed locally in clones, it can 
also lead to the formation of an entirely new secondary winglet attached to a 
normal wing (Zecca et al., 1995).    
 How BMP signaling can regulate both growth and patterning in the 
wing disc has been an enigma for quite some time. The dilemma arises because 
cell proliferation within the wing disc is uniform (Milán et al., 1996) and patterning 
is clearly coupled to gradient formation and interpretation. Explaining how 
uniform proliferation can be produced by a graded pattern of Dpp has proved 
difficult. Several hypotheses have been put forth including the idea that 
proliferation depends on the slope of the Dpp gradient (Day and Lawrence, 
2000), the rate of change in Dpp signal reception (Wartlick et al., 2011a), and the 
‘growth equalization model’ (Restrepo et al., 2014). At present the mechanism for 
producing uniform growth is unclear since all the models have some conflicts 
with certain observations. The major conflict arises from analysis of brk mutants 
and expression. That Brk plays a central role in regulating wing disc growth was 
  31 
initially revealed by analysis of loss-of-function clones, which in the flanks of the 
disc also leads to winglet formation similar to gain of BMP signaling (Campbell 
and Tomlinson, 1999). Subsequently, it was found that increased expression of 
brk in the entire disc leads to a severe reduction in disc size (Martín et al., 2004; 
Schwank et al., 2008) similar to loss of dpp. The real surprise, however, was that 
wing discs not only grow, but actually overgrow if they lose both brk and dpp 
(Campbell and Tomlinson, 1999; Schwank et al., 2008). This observation 
suggests that neither the slope model nor the temporal dynamics model is 
correct. One alternative is that Dpp and Brk do not directly regulate proliferation 
of wing disc cells, but instead modulate an underlying non-uniform proliferation 
pattern that is the result of other growth promoting signals such as insulin-TOR 
and/or the Hippo, and other Activin like signaling pathways (Restrepo et al., 
2014). 
 Two additional studies employing novel independent reagents, 
suggest that the Dpp gradient is not required for uniform growth (Akiyama and 
Gibson, 2015; Hamaratoglu et al., 2011). In the first study dpp is deleted from the 
Dpp producing cells in the wing disc, using a UAS>GAL4/FRT system (Akiyama 
and Gibson, 2015). Surprisingly, these discs proliferates uniformly resulting in a 
normal size tissue, even though brk expression is up-regulated in the wing 
pouch. This result argues against the Dpp-gradient and the growth equalization 
model and instead supports the temporal dynamics model perhaps due to other 
non-A/P boundary disc cells that still produce Dpp. In the second method, Dpp 
  32 
diffusion is restricted by a nanobody trapping method and once again there is 
uniform disc growth, supporting the growth equalization model (Harmansa et al., 
2015). Going forward it will be important to reconcile these observations. 
Furthermore, if and how Gbb signaling contributes to disc growth in the absence 
of a Dpp-gradient will be interesting to explore.  
 
1.7.7 BMP signaling in pupal wing development 
Dpp and Gbb also play important roles in vein specification and 
positioning, which begins in late larval stages and continues throughout pupal 
development (de Celis, 2003; O’Connor et al., 2006). During the late larval 
stages, induction of the BMP targets, sal and omb, dictate where some of the 
longitudinal veins (LV) will form (de Celis, 2003; de Celis et al., 1997). Soon after 
pupariation, dpp expression is lost at the A/P boundary and becomes localized to 
cells that form the LVs, and high levels of pMad are detected in these pre-vein 
cells (Conley et al., 2000). Intriguingly, the posterior crossvein (PCV), that forms 
slightly later at about 20 hours after puparium formation, also requires BMP 
signaling, but dpp is not expressed in primordial PCV cells. Nevertheless, these 
cells receive high levels of BMP signal as evidenced by strong pMad staining 
(Ralston and Blair, 2005). The mechanism appears to be similar to that used in 
the embryo where Dpp or a Dpp-Gbb heterodimer is shuttled away from the 
primordial LVs and concentrated at the site of the future PCV (Matsuda and 
  33 
Shimmi, 2012). This shuttling process requires several extracellular BMP 
modulators including sog, CV-2, CV-1 (a tsg homolog) and tlr (a tld homolog) 
(Figure 1-5, B) (O’Connor et al., 2006). Another factor, crossveinless-D which 
encodes a vittelogenin-like lipoprotein appears to regulate PCV formation by 
modulating Dpp movement as part of a lipid–Dpp–lipoprotein complex (Chen et 
al., 2012). 
 
1.7.8 Mad is a focal point for integration of cross-pathway signals 
Dpp signals are integrated with numerous other growth and patterning 
signals during imaginal disc development. In many cases, this interaction occurs 
through Mad, and two important points of integration within the wing disc involve 
the Hippo (see section 1.6.3) and Wingless (see section 1.6.4) signaling 
pathways (reviewed in (Baena-Lopez et al., 2012). The microRNA bantam (ban) 
is particularly interesting since it also responds to Dpp signaling (Martín et al., 
2004) and a direct link between the control of ban levels by Dpp and Hippo has 
been established (Oh and Irvine, 2011). On its own, Yki is not able to bind DNA 
but can do so when in a complex with other transcription factors. Mad can form a 
complex with Yki, and this complex is mediated through a PPXY motif located in 
the linker region between the Mad homology 1 (MH1) DNA binding domain of 
Mad and the C-terminal MH2 domain, a more typical site of regulatory interaction 
between Mad and other proteins (Oh and Irvine, 2010). The Mad-Yki complex 
  34 
was also shown to bind to a novel enhancer element in the ban promoter to 
augment ban transcription, thus providing an integration point for these two 
growth promoting signals (Oh and Irvine 2010).   
Mad is also the focal point of interaction with the canonical Wg pathway 
(Eivers et al., 2009; Eivers et al., 2011). Both in vivo and in vitro studies 
demonstrated that unphosphorylated Mad forms a complex with Armadillo 
(homologue of vertebrate β-catenin) to regulate wg target genes in both the 
embryo and wing disc. Upon Dpp signaling, Mad is titrated away from Armadillo, 
resulting in Wg-reporters being significantly down-regulated (Eivers et al., 2011). 
Once again, the linker region between the MH1 and MH2 domains of Mad plays 
an important role in mediating regulatory interactions between the two pathways. 
The linker region possesses several serines and tyrosines, which are 
phosphorylated by various kinases to control Mad stability (Alarcón et al., 2009; 
Kretzschmar et al., 1997; Pera et al., 2003). In particular, glycogen synthase 
kinase-3 (GSK3)-mediated phosphorylation of the linker is important for initiating 
Mad degradation via Smurf1 and it was proposed that both the Wg and Dpp 
functions of Mad are terminated by GSK3 phosphorylation of the linker (Eivers et 
al., 2011).  
A third signal intersection converging on Mad takes place between the 
Activin and the BMP signaling branches in the wing disc. Although these two 
branches appear to have diverged from one another long ago, the Activin-
specific type I receptor Babo retains an ability to activate Mad by C-terminal 
  35 
phosphorylation (Peterson et al., 2012). Whether this C-terminal Mad 
phosphorylation activity is utilized during normal development is still not clear, but 
results from using a dSmad2 null mutant further supports the idea that cross-
signaling by the Activin pathway impinges on Mad activity (Peterson and 
O’Connor, 2013; Sander et al., 2010). Interestingly, when dSmad2 protein is 
absent, Babo sends an ectopic signal that leads to pronounced overgrowth of the 
wing disc. The excessive growth is caused by down-regulation of brk, and this 
down-regulation requires binding of a Mad-Medea-Schnurri complex to the brk 
silencer elements. However, there was no detectable increase of C-terminal Mad 
phosphorylation, leading to the intriguing unresolved issue of how Mad is hyper-
activated by Babo in the absence of dSmad2 (Peterson and O’Connor, 2013). 
Taken together, these studies indicate that Mad is clearly at the nexus of 
integrating numerous signaling events that control wing growth and patterning.  
 
1.7.9 BMP signaling in other imaginal discs 
So far, our discussion has focused on the role of BMP signaling in wing 
disc growth and patterning since it is the best studied of the imaginal tissues. Not 
surprisingly, however, BMP signals also play important roles in the development 
of all imaginal discs. In fact, the name decapentaplegic indicates that all 15 
(decapenta) discs are defective (plegic) (Spencer et al., 1982). Here, we briefly 
examine the role of BMP signaling in the leg, eye and genital imaginal discs. 
  36 
More detailed reviews cover the development of the eye (Curtiss and Mlodzik, 
2000), leg (Estella et al., 2012) and genital discs (Estrada et al., 2003; Sánchez 
et al., 2001).    
In the leg disc, Dpp synergizes with Wg to give proximal/distal (PD) 
positional information the tissue with distal being the center (Estella and Mann, 
2008; Lecuit and Cohen, 1997). Along the A/P boundary of the leg disc dpp is 
expressed in the dorsal compartment and wg in the ventral.  This creates a zone 
in the center of the disc where both ligands are present at high concentrations, 
which is required to induce the expression of the distal marker distal less (dll). 
Cells surrounding the dll expression domain sense moderate levels of Dpp and 
Wg and turn on dachshund (dac), a medial leg marker. Cells in the periphery give 
rise to proximal domains of the leg and sense low levels of the ligands leading to 
expression of homothorax and teashirt. Patterning of dll and dac are thought to 
result from brk repression, a mechanism that poses striking similarity with the 
wing disc (Estella and Mann, 2008). Thus, while the details of patterning in the 
leg disc are different from those in the wing, the basic function of Dpp as a 
morphogen that functions, in part, through the repression of brk, is nevertheless 
the same in both tissues. 
In the eye imaginal disc, the responses to Dpp are notably different from 
those in other discs. In this tissue, dpp is expressed only in the morphogenetic 
furrow, which migrates posterior to anterior during late larval stages (Baker, 
2001). The Dpp signaling response varies depending on the position of the cells 
  37 
relative to the furrow. Cells anterior of the furrow are stimulated to proliferate, 
while cells in and abutting the furrow undergo cell cycle arrest (Baker, 2001).  
Cell cycle arrest is necessary for proper eye differentiation since mutant clones 
defective in Dpp signaling are delayed in entering G1 arrest and do not fully 
differentiate (Firth et al., 2010; Horsfield et al., 1998). Although the mechanism 
for the dual nature of Dpp signaling to induce both cell proliferation and G1 arrest 
is unresolved, it is likely that multiple signaling pathways, including those 
activated by Wg, Hh, Notch, and EGF (see section 1.6.1), finely tune this process 
(Amore and Casares, 2010).  
Dpp signaling also plays an important role in genital disc development, 
which gives rise to the adult internal and external genitalia and analia. Several 
distinguishing characteristics of this disc set it apart from the others. It is the only 
disc that is located medially, formed by the fusion of cells originating from three 
embryonic segments, it is an unpaired disc (i.e. not one for each side of the 
larva,) and it is sexually dimorphic (Estrada et al., 2003; Sánchez and Guerrero, 
2001). Nevertheless, the genital disc has some similarity to other discs, such as 
the leg, in the sense that hh expression in the posterior compartment induces 
expression of dpp and wg in the anterior compartment, which in turn induces dll 
expression that is required for development of the disc in both males and females 
(Sánchez and Guerrero, 2001; Sánchez et al., 2001). 
 
  38 
1.7.10 TGF-β family signaling in the nervous system  
The Drosophila NMJ, a collection of synapses made on body wall muscles 
by motor neurons, has long served as an excellent model for studying synapse 
formation and function. The NMJ grows substantially during larval life to 
accommodate the rapidly growing body wall muscles, and several trans-synaptic 
signaling pathways have been shown to play important roles in coordinating the 
pre- and postsynaptic development at the larval NMJ (Dani and Broadie, 2012). 
Both branches of TGF-β family signaling have important roles at the NMJ (Figure 
1-6), and BMP signaling has been particularly well studied. The primary ligand 
involved is Gbb, which is expressed in the muscles and the central nervous 
system (CNS) beginning at the embryonic stage (McCabe et al., 2003).  
Mutations in gbb cause a loss of pMad accumulation in motor neuron nuclei as 
well as a reduced NMJ size, aberrant presynaptic ultrastructure, and defective 
neurotransmission (McCabe et al., 2003). The defective synaptic growth of gbb 
null mutants is only fully rescued when gbb expression is restored in muscles 
and not in the CNS. These observations suggest that the Gbb signal acts in a 
retrograde fashion to control presynaptic growth in the motor neurons (McCabe 
et al., 2003).  
 Similar phenotypes in pMad level, NMJ size, neurotransmitter release, 
and synaptic ultrastructure were also observed in mutations of the type II 
receptor wit (Aberle et al., 2002; Marqués et al., 2002). The expression of wit is 
restricted to motor neurons in the neuromuscular system and restoration of wit in 
  39 
the motor neurons rescues synaptic size, supporting the idea that Wit acts as the 
primary type II receptor for Gbb in motor neurons. Likewise, null mutations in all 
other BMP signal transduction components, including tkv, sax, mad and medea, 
phenocopy the gbb and wit null mutations indicating that canonical BMP 
signaling is the main regulator of synaptic growth at the NMJ (McCabe et al., 
2004; Rawson et al., 2003).  
The identities of target genes in motor neurons that regulate synaptic 
growth is largely unknown. However, recent studies utilizing molecular genetic 
tools that allow for temporal regulation of Gbb signaling at the NMJ identified 
some molecular mechanisms through which Gbb affects synapse structure and 
function. These studies demonstrated that synaptic structure and function use 
genetically separate pathways with an early transient embryonic signal needed 
for synaptic growth, while continuous Gbb signaling is required for maturation of 
neurotransmitter release properties (Berke et al., 2013). One BMP target gene 
required for regulating synaptic growth is trio, which encodes a guanine 
nucleotide exchange factor (GEF) that acts on Rac GTPases (Ball et al., 2010). 
Since previous studies demonstrate that GTPases control axon growth and 
guidance through alterations in the actin cytoskeleton (Dickson, 2001; Fan et al., 
2003), it was postulated that Trio could promote synaptic growth also by 
modulation of the actin cytoskeleton via Rac (Ball et al., 2010).  However, a direct 
relationship between Rac activation and changes in actin filaments is yet to be 
demonstrated. In parallel to stimulating trio expression, Wit signaling also leads 
  40 
to stimulation of Lim domain kinase 1 (Limk1) activity through a non-canonical 
pathway. Since Lim kinase is implicated in rapid bouton budding in response to 
elevated synaptic activity and synaptic stabilization (Eaton and Davis, 2005; 
Piccioli and Littleton, 2014), this may be yet another means by which the Gbb 
signal influences synaptic growth.  
In addition to promoting NMJ growth and presynaptic structural 
maturation, BMP signaling also plays a pivotal role in regulating synaptic 
transmission at the NMJ.  Strong BMP pathway mutants display reductions in the 
amplitude of evoked junctional potential (EJP) and the frequency of miniature 
EJPs (mEJP) (Aberle et al., 2002; Marqués et al., 2002; McCabe et al., 2003; 
Rawson et al., 2003). Unlike synaptic growth that is predominantly regulated by 
retrograde BMP signaling, the defective synaptic transmission phenotypes of gbb 
mutants are only completely rescued when gbb expression is restored by a pan-
neuronal driver (Aberle et al., 2002; McCabe et al., 2003), indicating that 
presynaptic Gbb is required for proper neurotransmission. The smaller 
magnitude of EJPs has also implied that homeostatic regulation of synaptic 
efficacy is compromised in the BMP pathway mutants. It was later demonstrated 
that BMP signaling is continuously required in the motor neurons to confer 
competence for the rapid induction of synaptic homeostasis (Goold and Davis, 
2007). In terms of the effects on neurotransmission, the only BMP-responsive 
target gene identified to date is twit, which encodes a Ly6 neurotoxin-like 
molecule. Restoring twit expression in wit mutant motor neurons partially rescues 
  41 
neurotransmitter release defects, although the molecular mechanism remains 
obscure (Kim and Marques, 2012).  
Since BMP signaling has profound effects on NMJ structure and function, 
it is not surprising that its activity is tightly controlled to prevent uncoordinated 
growth of the synapses. Multiple molecular mechanisms have been implicated in 
regulating BMP signaling at the NMJ. In muscles, Gbb release is inhibited by 
Drosophila Cdc42-interacting protein 4 (dCIP4) acting downstream of Cdc42 and 
activating the Wsp (Drosophila orthologue of mammalian Wiskott-Aldrich 
syndrome protein, Wasp) pathway (Nahm et al., 2010). The Cdc42-Wsp pathway 
is, in turn, inhibited by Drosophila Rich (dRich), a Cdc42-selective GAP (Nahm et 
al., 2010). Therefore, a complex regulatory loop appears to be employed to 
control the release of Gbb. In the presynaptic motor neurons, hyper-activation of 
BMP signaling is prohibited by highwire, a ubiquitin ligase that presumably 
targets Medea for protein degradation (McCabe et al., 2004). The activated 
receptors are also subject to negative regulation by internalization. Mutations in 
nwk, spin and spict whose products act in, or interact with, endocytic machinery 
result in overgrowth of the synapses (Oconnor-Giles et al., 2008; Sweeney and 
Davis, 2002; Tan et al., 2007). Finally, retrograde signaling of Gbb also occurs in 
the central motor circuit, which is necessary to strengthen the synaptic activity. 
Therefore, it appears that the retrograde signaling is a general theme by which 
Gbb regulates synaptic development and function (Baines, 2004). On the other 
hand, release of Gbb from the presynaptic side is promoted by Crimpy, a 
  42 
homolog of vertebrate Cysteine-rich transmembrane BMP regulator 1 (CRIM1), 
which binds Gbb and delivers it to a dense core vesicle (DCV) (James and 
Broihier, 2011). Interestingly, the ectodomain of Crimpy is also released together 
with Gbb from the DCV upon exocytosis. This has been proposed to help 
discriminate the presynaptic and postsynaptic pools of Gbb, thus setting the 
directionality of BMP signaling at the NMJ. 
The retrograde Gbb signaling at the NMJ results in accumulation of pMad 
in the nuclei of motor neurons. In addition to the nuclear pMad, another pool of 
pMad has been identified. This pool of pMad is localized to the presynaptic side 
of the synapses at the NMJ and is regulated differently from the nuclear pMad 
(Sulkowski et al., 2014). Specifically, the level of synaptic pMad is independent of 
Gbb, but is positively regulated by the activity of postsynaptic iGluRs containing 
glutamate receptor IIA (type-A receptor). The synaptic pMad in turn stabilize the 
A-type glutamate receptors suggesting a positive feedback loop between the 
presynaptic and postsynaptic molecules. This has been proposed to be a 
mechanism to coordinate the maturation of synapses to the activity.         
In contrast to BMP signaling, whose role in synaptic formation and 
function is well documented, relatively little is known about the role of the activin 
pathway in the regulation of NMJ development and activity, even though all three 
activin ligands are expressed in at least one cell-type of the neuromuscular 
system (Brummel et al., 1999; Gesualdi and Haerry, 2007; Lo and Frasch, 1999; 
Serpe and O’Connor, 2006; Zheng et al., 2003). Studies of babo, dSmad2, and 
  43 
Actβ mutants indicate that Actβ is a motor neuron-derived anterograde signal that 
is necessary for achieving normal levels of GluRIIA and GluRIIB densities in 
muscle at the postsynaptic side of the NMJ (Figure 1-6), as well as proper resting 
membrane potential of the muscle (Kim et al., 2014). Actβ appears to control the 
synaptic GluRIIA density through a post-transcriptional mechanism while it 
regulates the GluRIIB density via dSmad2-dependent transcriptional activation. 
 
1.7.11 Activin signaling stimulates neuroblast proliferation  
In addition to its role at the NMJ, Activin signaling also has other roles in 
the nervous system including regulation of neuroblast proliferation, control of 
neurite outgrowth and target selection, as well as neuronal remodeling during 
metamorphosis. These activities are accomplished by deployment of the Activin-
type ligands, i.e. Actβ, Daw and Myo, from different source cells in the nervous 
system acting on different target cells. In most cases, this signaling is canonical 
through Babo and dSmad2, but there is one example where non-canonical 
signaling appears to be employed.  
One major function of Activin signaling in the nervous system is to 
stimulate production of neurons, which are generated from neuroblasts in the 
brain. Loss-of-function mutations in babo and dSmad2 produce small brains due 
reduced proliferation of neuroblasts and their daughter cells, while expression of 
babo specifically in neuroblasts rescues brain size (Zhu et al., 2008). The ligands 
  44 
Actβ and Daw have been implicated in this process. Actβ is expressed in 
numerous neurons within the central brain and ventral ganglia, while daw is 
expressed in subsets of glial cells. Myo may also be involved, since it, too, is 
expressed in many glial cells (Lo and Frasch, 1999). Mechanistically, activin 
signaling appears to control proliferation of neuroblasts by promoting S to M 
phase transition of the cell cycle (Zhu et al., 2008).  
 
1.7.12 Activin signaling and axon guidance and target selection 
In addition to generating neurons, activin signaling also regulates several 
aspects of axon targeting in different contexts. In the embryonic nervous system, 
activin signaling plays a role in guiding motor neuron axons to their target 
muscles. In daw mutant embryos, motor neurons leaving the CNS have 
pathfinding defects in both intersegmental nerve and segmental nerve roots 
(Parker et al., 2006; Serpe and O’Connor, 2006). These defects are also seen 
in babo and dSmad2 mutant embryos (Parker et al., 2006; Serpe and O’Connor, 
2006) indicating that canonical signaling is responsible. Because expressing 
dominant-negative forms of either Babo or Punt in the motor neurons also cause 
pathfinding defects, the target of Daw signaling appears to be the motor neuron 
itself and not the muscle (Parker et al., 2006). In addition, because daw 
expression in either the muscle or glia rescues pathfinding defects and excess 
daw expression is not detrimental, daw appears to provide a permissive cue for 
  45 
motor neuron axon guidance (Parker et al., 2006). Interestingly, mutants 
in tlr also phenocopy the pathfinding defects of daw mutants (Serpe and 
O’Connor, 2006). Tlr was found to cleave the prodomain of Daw, as well as Actβ 
and Myo, and, in the case of Daw, cleavage enhances signaling in cell culture 
assays. These observations suggest that, as described above for Scw, 
prodomain processing of activin-like ligands at sites distinct from the normal furin 
maturation sites may be important for full signaling activity, perhaps by 
stimulating complete dissociation of the prodomain from the carboxy-terminal 
ligand domain (Serpe and O’Connor, 2006). Similar activating cleavages in 
prodomains of several vertebrate ligands have also been reported (Wolfman et 
al., 2003). 
During the larval stage, photoreceptor axons must be targeted properly for 
light and color information to be processed correctly, and Actβ plays a role in 
regulating proper photoreceptor axon termination in the medulla. Clonal loss 
of babo or dSmad2 in R7 photoreceptors causes their axons to target to the 
correct layer, but move laterally and enter the wrong column (Ting et al., 2007). 
Actβ is expressed in R7 photoreceptors, and Actβ RNAi in the photoreceptors 
also causes axon mis-targeting (Ting et al., 2007). These studies indicate that 
Actβ expression in R7 photoreceptors restricts their targeting to a single column 
in the medulla through an autocrine signaling mechanism (Ting et al., 2007). 
Actβ also signals in a juxtacrine manner to negatively regulate dendritic 
branching and termination of medulla interneurons, which receive input from 
  46 
photoreceptors. In this case, Actβ derived from R7 or R8 photoreceptors signals 
to Dm8 or Tm20 medulla neurons, respectively, to regulate their dendritic field 
size (Ting et al., 2014). Loss-of-function babo and dSmad2 mutant clones in 
medulla interneurons produce expanded dendrites, whereas neurons with 
increased reception of activin signals have reduced dendrites. In loss-of-function 
mutants the expanded dendrites form ectopic membrane connections with 
presynaptic sites on multiple photoreceptors, potentially disrupting visual 
processing (Ting et al., 2014). 
Activin signals also function to regulate MB neuron β-lobe axon growth. 
MB neurons are responsible for olfactory learning and memory. Expression of 
activated Babo causes axon truncation, whereas loss of babo results in 
overgrowth (Ng, 2008). This is independent of dSmad2 and requires the actin 
cytoskeleton regulators Limk1, Rho, and Rac. The identity of the responsible 
ligand has not been determined. This example is one of only two cases 
in Drosophila in which non-Smad signaling is responsible for mediating a 
response. 
 
1.7.13 Activin signaling and neuronal remodeling 
Apart from roles in axon guidance and target selection, activin signaling is 
also required during metamorphosis for MB remodeling. The MB undergoes 
stereotypic remodeling during the pupal phase to eliminate larval-specific 
  47 
connections and to form new connections required for proper adult behaviors. 
The larval MB has two major branches of γ neurons: medial and dorsal. Both 
branches are pruned during metamorphosis, and only the medial lobe remains in 
the adult MB. Mutations in babo and dSmad2 prevent pruning of dorsal and 
medial γ neurons of the MB, and these defects are rescued by expressing the 
proper wild-type gene in the MB neurons (Zheng et al., 2003).  One major target 
of activin signaling in the remodeling MB neurons is the gene encoding the 
ecdysone receptor EcR-B1. Ectopic expression of EcR-B1 in the MB neurons 
partially rescues the pruning defect (Zheng et al., 2003).  Although it was 
originally suggested that Actβ was the responsible ligand based on RNAi 
phenotypes, further studies using loss-of-function mutants demonstrate that glial-
derived Myo provides the signal (Awasaki et al., 2011).  In this example, Myo 
appears to signal primarily through the BaboA isoform (Awasaki et al., 2011) and 
can use either Punt or Wit as a type II receptor since only when both are 
eliminated is a MB remodeling defect observed (Zheng et al., 2003).   
  This signaling event is also noteworthy since efficient signaling requires a 
novel co-receptor in addition to the normal type I and type II receptors. Genetic 
screens for additional factors that regulate MB remodeling identified plum, a gene 
that codes for an immunoglobulin superfamily protein. Mutations in plum lead to 
loss of EcR-B1 expression and defective MB remodeling (Yu et al., 2013). Since 
these phenotypes can be rescued by expressing activated Babo in MB neurons, 
but not by overexpressing plum in babo mutant MB clones, Plum appears to act 
  48 
upstream of receptor activation (Yu et al., 2013).  Limited structure-function 
studies demonstrate that the extracellular domain of Plum is required for rescue, 
but the cytoplasmic domain is dispensable (Yu et al., 2013).  At present, the best 
guess is that Plum acts to either stabilize receptor complexes and/or to facilitate 
Myo binding to the receptor complex, although no biochemical interactions 
between any of these components have been reported.  
 
1.7.14 Role of TGF-β family signaling in physiological and metabolic 
homeostasis 
Roles of TGF-β family signaling in developmental processes are well 
established and extensively studied. Nevertheless, TGF-β family signaling 
components continue to be expressed throughout the lifespan of an animal and 
in various adult tissues, signifying potential roles of the TGF-β family signaling 
pathways in key physiological or homeostatic processes. Investigating the role of 
TGF-β family signaling in physiology is an active field of research, and the 
involvement of the TGF-β family in the regulation of physiological homeostasis in 
Drosophila larvae and adults has been demonstrated in a number of studies. In 
this section I highlight our understanding of how TGF-β family signaling in 
Drosophila regulates the following four key homeostatic and physiological 
processes: 1) metabolic homeostasis, 2) hormonal signaling, 3) innate immunity, 
and 4) tissue homeostasis. 
  49 
 
1.7.15 TGF-β family signaling in metabolic homeostasis 
TGF-β family signaling components are expressed in metabolically active 
tissues in both vertebrates and invertebrates, and their roles in regulating 
metabolism are gaining attention (Bertolino et al., 2008; Ghosh and O’Connor, 
2014; Zamani and Brown, 2011). In Drosophila, both the TGF-β family ligand 
Dawdle (Daw) and the BMP family ligand Glass-bottom boat (Gbb) have been 
implicated in metabolic regulation. 
The activin-like ligand Daw regulates insulin/insulin-like growth factor 
signaling (IIS) in feeding third instar larvae (Ghosh and O’Connor, 2014). 
Consistent with loss of IIS, daw mutant larvae show a significant increase in 
circulating sugar (glucose + trehalose) concentration, total triacylglycerol and 
glycogen content, and a significant reduction in Akt activation in the peripheral 
tissues (Ghosh and O’Connor, 2014). While these mutant animals did not show 
any change in expression of dilps in the insulin producing cells (IPCs), they were 
defective in the release of Dilps from the IPCs (Ghosh and O’Connor, 2014).  
Independent of its role in regulating IIS, canonical Smad signaling 
downstream of Daw also regulates the internal pH balance, most likely by 
altering the output of acidic TCA cycle intermediates primarily in the fat body (FB) 
(Ghosh and O’Connor, 2014). FB-specific RNA sequencing of daw mutants and 
control flies revealed increased expression of multiple nuclear-encoded 
  50 
mitochondrial genes, including enzymes of the TCA cycle, electron transport 
chain, β-oxidation and ketogenesis in the daw mutants (Ghosh and O’Connor, 
2014).  Additionally, metabolomics analysis revealed increased accumulation of 
multiple TCA cycle intermediates in these mutants. These results point towards a 
transcriptional role of Daw in mitochondrial biogenesis, energy metabolism, TCA 
cycle activity and pH balance. The involvement of Daw in expression of nuclear 
encoded mitochondrial genes may be reminiscent of the proposed role of Activin-
A in mitochondrial biogenesis in vertebrates (Zamani and Brown, 2011). 
Daw may regulate metabolic processes in a systemic dose-dependent 
manner. Expressing daw in any larval tissue could completely rescue larval 
lethality associated with mutations in daw, and had a graded effect in rescuing 
the metabolic phenotypes of daw mutants depending on the size of the tissue. 
Analyses of phospho-dSmad2 (pdSmad2) levels in the FB showed that Smad2 
activation in the larval FB is primarily mediated by Daw and that the FB is poised 
to respond to a wide range of Daw signaling. Consistent with the endocrine 
nature of Daw signaling, expressing daw in a variety of larval tissues could 
rescue pdSmad2 levels in a daw mutant FB (Ghosh and O’Connor, 2014). These 
results indicate that Daw acts like a metabolic hormone capable of dose-
dependently regulating cellular metabolism. Intriguingly, unlike most hormones, 
daw is expressed in multiple larval tissues, and it will be interesting to learn how 
each of these tissues uses this metabolic ligand for systemic communication. 
One possibility is that daw expression in each tissue is regulated by different 
  51 
environmental stimuli and that Daw then acts on other tissues to bring about 
systemic changes to cope with the stimuli.  
The involvement of the Drosophila TGF-β family ligand Daw in sugar 
homeostasis is further demonstrated by work showing that nutrient-sensitive 
expression of daw is required for inducing glucose repression (GR) in the 
Drosophila intestine (Chng et al., 2014). Glucose repression (GR) is a 
phenomenon whereby feeding of excessive dietary glucose leads to repression 
of amylase in the gut, presumably in an effort to protect the animal against 
deleterious effects of a high sugar diet (Benkel and Hickey, 1986; Hickey and 
Benkel, 1982; Musselman et al., 2011; Na et al., 2013). Smad signaling activated 
by Babo and dSmad2 mediates GR by negatively regulating the expression of 
digestive enzymes (amylases, hydrolases and lipases) in the gut in response to 
high sugar diet (Chng et al., 2014). This effect is mediated by the Babo isoform C 
in the gut, which is specific to Daw signaling (Chng et al., 2014; Jensen et al., 
2009). Importantly, in response to high sugar diet, Daw is released from the adult 
fat body and signals to the gut to repress expression of digestive enzymes 
including amylase, further confirming the endocrine nature of Daw signaling. It is 
interesting to note that expression of oxido-reductase genes was also 
significantly suppressed in the gut when flies were kept on a high sugar diet. 
Since a high sugar diet increases Daw signaling in the gut, this finding is 
consistent with a role for Daw signaling in repressing the expression of 
  52 
mitochondrial genes, including oxido-reductases, similar to what is seen in whole 
animal daw mutants (Ghosh and O’Connor, 2014).  
Additional evidence suggests that Daw is one of the primary effectors of a 
conserved sugar sensing pathway mediated by the ChREBP/MondoA-Mlx 
complex (Mattila et al., 2015). The MondoA-Mlx transcription factors are 
activated by sugars and are essential for mediating multiple downstream 
processes essential for conversion of sugars to lipids and utilization of sugars. 
The daw promoter contains a carbohydrate response element that is occupied by 
Mlx in both S2 cells and in Drosophila larvae indicating that daw expression is 
directly regulated by Mondo-A/Mlx. Additionally, Daw is required and regulates 
the expression of a second key target of Mondo-A/Mlx called sugarbabe (sug) 
(Mattila et al., 2015). These findings put Daw firmly in a major sugar sensing and 
sugar metabolism pathway in Drosophila. Whether activin signaling in 
vertebrates is also a downstream target and effector of Mondo-A/Mlx complex 
remains to be determined. 
Daw has also been implicated in lifespan extension in Drosophila.  A 
screen for transcriptional targets of dFOXO identified daw as a potential target, 
and muscle-specific knockdown of daw leads to increased lifespan (Bai et al., 
2013). Loss of daw in the muscle affects lifespan possibly by increasing macro-
autophagy that helps remove age-related accumulation of protein aggregates in 
the muscle, thereby improving muscle function (Bai et al., 2013).  Interestingly, 
they also found that daw-RNAi in the muscle can reduce Dilp2 levels in 
  53 
circulation, whereas daw-RNAi in the FB leads to an increase in Dilp2 in the 
hemolymph (Bai et al., 2013). While these observations support a role of Daw in 
regulating IIS in the adult fly as well, it remains to be explained how tissue-
specific knockdown of a ligand, which clearly works as an endocrinal systemic 
signal in the larva, can lead to opposing phenotypes in the adult. The relative 
contributions of the muscle and FB to circulating Daw levels and potential 
compensatory changes in daw expression when it is knocked down in any single 
tissue could explain some of these findings.  
The BMP ligand Gbb has also been proposed to regulate metabolic 
processes, initially based on a striking morphological defect exhibited by gbb 
mutants in which the FB takes on a glassy appearance instead of its normal 
opaqueness (hence the name Glass bottom boat).  Characterization of these 
mutant larvae revealed that the FB exhibits nutrient storage and morphological 
characteristics resembling a state of starvation (Ballard et al., 2010). Additionally, 
gbb mutants show alterations in the expression of multiple starvation response 
genes. Surprisingly, monitoring lipid uptake using a fluorescently labeled lipid 
derivative (Bo-C12) reveals that the gbb mutants show an increased rate of 
nutrient uptake, indicating defects in the ability to store nutrients. While Gbb 
produced by the FB regulates FB morphology and nutrient storage in a cell-
autonomous manner, Gbb signaling in the FB may only be partially responsible 
for the increased nutrient uptake phenotype observed in gbb mutants (Ballard et 
  54 
al., 2010). The mechanistic details of how Gbb affects utilization of absorbed 
nutrients remains unexplained. 
 
1.7.16 TGF-β family signaling regulates hormonal control of Drosophila 
development. 
Like other insects, Drosophila uses two primary hormonal signals, juvenile 
hormone (JH) and ecdysone (E), to coordinately regulate transitions in larval 
development (see section 1.5.3). TGF-β family signaling appears to work 
upstream of these hormonal signals by controlling the production of both these 
hormones, presumably in response to developmental or environmental cues 
(Gibbens et al., 2011; Huang et al., 2011). Both gain and loss-of-function studies 
show that activin signaling is required in the prothoracic gland (PG), the site of E 
production and release, to generate the large pulse of E necessary for entering 
metamorphosis (Gibbens et al., 2011).  In the absence of canonical activin 
signaling in the PG, the larvae arrest at the third instar stage and do not undergo 
metamorphosis. This phenotype results from a requirement for activin signaling 
in the PG to make it competent to respond to two other hormonal signals, 
prothoracicotropic hormone (PTTH) and insulin.  In the absence of activin 
signaling, expression of Torso, the PTTH receptor, and InR, the insulin receptor, 
and several other downstream components in the insulin signaling pathway, are 
all down-regulated in the PG (Gibbens et al., 2011). Since each of these two 
  55 
signaling pathways is required for high-level expression of several key E 
biosynthetic enzymes, their simultaneous loss eliminates production of the E 
pulse that is required for initiating metamorphosis. A remaining question is the 
identity of the TGF-β ligand that signals in the PG since loss of any one ligand 
(Actβ, daw or myo) does not show larval developmental arrest phenotypes. This 
observation suggests redundancy among the ligands for providing competence 
to the PG for reception of PTTH and insulin signals. 
In contrast to the involvement of activin signaling in the control of E 
production, JH synthesis is under the control of the BMP ligand Dpp (Huang et 
al., 2011). JH is critical for determining the nature of developmental transitions in 
insects. In the presence of JH, E induces a larval-larval molt, whereas, in the 
absence of JH, E induces a larval-pupal or pupal-adult molt. Using an elegant 
genetic screen, tkv and Mad were identified as positive regulators of JH signaling 
in the larva (Huang et al., 2011). JH is synthesized in the corpus allata (CA), and 
glutamatergic signals emanating from the brain induce dpp expression in the CA. 
Dpp then cell-autonomously induces production of the JH-synthesizing enzyme 
JH acid methytransferase to stimulate JH production in the developing larvae. 
 
  
  56 
1.8 STATEMENT OF THESIS WORK 
Inter-organ communication is vital for organisms. As discussed above, in 
Drosophila both branches of TGF-β suprefamily participate in regulating a wide 
variety physiological and developmental processes, often through inter-organ 
signaling. However, numerous outstanding questions that remain. Among them is 
the question of organ size coordination. The data presented in this dissertation 
aims to precisely define how TGF-β/Activin like ligands regulate overall animal 
growth as well as organ size. In chapter two, I discuss how Activin-β secreted by 
Motoneurons affect muscle and body size. In chapter three, I discuss how 
Myoglianin secreted by the muscles affect imaginal disc size. In chapter four, I 
conclude by bringing together the central finding from chapters three and four in 
an effort to explain how multiple axis of TGF-β signaling in Drosophila may be a 
mechanism of achieving proper organ to body size scaling. I speculate on how 
these findings relate to static allometry or organ size in Drosophila melanogaster. 
  
  57 
CHAPTER I FIGURES 
  
  58 
 
Figure 1-1. Static allometry of organ size within and among species. 
(A) For a given group of individuals, size of any two traits can be mapped on a 
graph, represented by gray ellipse. Black line represents the scaling relationship 
between the sizes of those two traits. The slope of the linear regression is the 
allometric coefficient. (B) Comparison of the scaling relationships among different 
groups of individuals can reveal different allometric scaling coefficients. White 
ellipse represent isometric scaling, light gray ellipse represent hypoallometric 
scaling where organ size is less variable in the population, dark gray ellipse 
represent hyperallometric scaling where organ size is highly variable relative to 
body size. (C) Example of different scaling relationships in various closely related 
species of Onthophagus beetles. Plotting horn length vs body size demonstrates 
a tight scaling relationship within species. Comparing different species 
demonstrates that scaling relationships can vary dramatically. Figure adapted 
from (Frankino et al., 2009). 
 
  
  59 
 
Figure 1-2. Limb xenograft experiments by Twitty and Schwind.  
Anterior limb bud primordium from two closely related species of salamander, 
Amblystoma punctatum (smaller animal, left) and Amblystoma trigrinum (larger 
animal, right), were grafted (gr) onto the other’s body. Both grafts grew to match 
the size of the donor animal, not the host. This indicates that tissue intrinsic 
factors regulate organ size. Image adapted from (Twitty and Schwind, 1931) 
  
  60 
 
 
Figure 1-3. Core transforming growth factor β (TGF-β) family signaling 
components in Drosophila. 
Activin branch: Three ligands signal through the activin-specific type I receptor 
Babo. Each ligand is thought to have a dedicated receptor isoform, although 
evidence for Actβ-BaboB is lacking. Ligand binding induces formation of a 
receptor complex of both Babo and either of the type II receptors, Punt or Wishful 
thinking (Wit). Constitutively active type II receptors phosphorylate Babo, which 
activates dSmad2. Phosphorylated dSmad2 binds to Medea and translocates to 
the nucleus to regulate the transcriptional response. Bone morphogenetic protein 
(BMP) branch: Four ligands signal through shared the BMP-specific type I 
receptors Tkv and Sax and either Punt or Wit. The ligands are thought to 
primarily form homodimers, but there is one example of a heterodimer: Dpp–
Scw. Mav is a divergent ligand based on sequence, but signals to activate Mad. 
Activation of type II receptors causes phosphorylation of type I receptors and 
subsequent phosphorylation of Mad, which then complexes withMedea to 
regulate transcription. In the absence of dSmad2, Babo can phosphorylate Mad 
and can also activate theMad transcriptional response. Myo,Myoglianin; Actb, 
  61 
Activin-b; Daw, Dawdle; Babo, Baboon; Mav, Maverick; Gbb, Glass-bottom boat; 
Dpp, Decapentaplegic; Scw, Screw; Sax, Saxophone; Tkv, Thickveins; Wit, 
Wishful thinking. Figure adapted from (Upadhyay et al., 2017) 
 
 
 
 
 
Figure 1-4. TGFβ family accessory factors in Drosophila 
List of known proteins that interact with core members of the TGFβ signaling 
pathway. Figure adapted from (Upadhyay et al., 2017) 
 
 
  
  62 
 
Figure 1-5. Dpp signaling in Drosophila wing development. 
(A) During larval development, dpp (blue, top) is expressed along the A/P border 
and its gene product spreads to both compartments (blue arrows). High Dpp 
signaling in the middle of the disc results in activation of Mad (blue, below), which 
silences brk (red). The inverse gradients of pMad and Brk form the nested 
expression pattern of sal and omb. pMad is slightly lower in cells abutting the A/P 
axis due to local tkv down-regulation (Funakoshi et al. 2001). (B) Posterior 
crossvein (PCV) forms between the L4 and L5 veins (top), which begins during 
pupal development. Dpp–Gbb heterodimers bound by Sog (purple) and 
crossvein (dark green) allow for facilitated diffusion of ligands into the 
presumptive PCV space. Tolloid-related (Tlr) cleaves Sog and allows for 
signaling to occur. The initial broad signaling induces expression of CV-2, which 
further sharpens the signaling, resulting in PCV formation. Figure adapted from 
(Upadhyay et al., 2017) 
  
  63 
 
Figure 1-6. BMP and Activin signaling at the neuromuscular junction 
Activin-like ligands from motoneurons activate dSmad2 in the muscle. Signaling 
induces transcription of glurIIB and an unknown factor(s) that controls 
posttranscriptional processing or mRNA stability of glurIIA. Muscle released Gbb 
binds to Wit-Tkv/Sax complex in the motor neuron and stimulates Mad 
phosphorylation. The resultant pMad–Medea complex activates the transcription 
of trio and twit whose products promote synaptic growth and control spontaneous 
vesicle release, respectively. The expression of Gbb in the muscle is fine-tuned 
by glia derived Mav. Figure adapted from (Upadhyay et al., 2017). 
  
  64 
 
Chapter II 
 
Motoneuron-derived Activinβ regulates 
Drosophila body size and tissue-scaling during 
larval growth and adult development 
 
 
 
 
 
 
 
 
 
 
 
 
 
Others that contributed to this chapter:  
Lindsay Moss-Taylor conducted experiments for figures: 2-1, 2-4 G, 2-5, 2-7, 2-8 
(A-E), 2-9, and 2-12. Xueyang Pan conducted experiments for figures: 2-4 (A, C-
E, H). Myung-Jun Kim conducted experiment for figures: 2-8 (F-H). Michael B. 
O’Connor conducted experiments for figures: 2-6, 2-11, 2-13, 2-14, and 2-15 A-
C. All other experiments were done by me. 
  
  65 
SUMMARY 
Correct scaling of body and organ size is crucial for proper development 
and survival of all organisms. Perturbations in circulating hormones, including 
insulins and steroids, are largely responsible for changing body size in response 
to both genetic and environmental factors.  Such perturbations typically produce 
adults whose organs and appendages scale proportionately with final size. The 
identity of additional factors that might contribute to scaling of organs and 
appendages with body size is unknown. Here we report that loss-of-function 
mutations in Drosophila Activinβ (Actβ), a member of the TGF-β superfamily, 
lead to production of small larvae/pupae and undersized rare adult escapers. 
Morphometric measurements of escaper adult appendage size (wings, legs), as 
well as heads, thoraxes, and abdomens, reveal a disproportional reduction in 
abdominal size compared to other tissues. Similar size measurements of 
selected Actβ mutant larval tissues demonstrate that somatic muscle size is 
disproportionately smaller when compared to fat body, salivary glands, 
prothoracic glands, imaginal discs and brain. We also show that Actβ control of 
body size is dependent on canonical signaling through the transcription-factor 
dSmad2 and that it modulates the growth rate, but not feeding behavior, during 
the third instar period. Tissue and cell-specific knockdown and overexpression 
studies reveal that motoneuron derived Actβ is essential for regulating proper 
body size and tissue scaling. These studies suggest that, unlike in vertebrates 
where Myostatin, and certain other Activin-like factors act as systemic negative 
  66 
regulators of muscle mass, in Drosophila Actβ is a positive regulator of muscle 
mass that is directly delivered to muscles by motoneurons. We discuss the 
importance of these findings in coordinating proportional scaling of insect muscle 
mass to appendage size. 
 
INTRODUCTION 
Some members of the animal kingdom, including most species of fish, 
amphibians, lizards, turtles, and salamanders, undergo indeterminate growth and 
increase their biomass throughout their lifespan. In contrast, birds, mammals and 
many insect species exhibit determinate growth whereby ideal body length and 
weight is fixed upon reaching sexual maturity. This process produces a more 
limited range of sizes that are characteristic for the species (Hariharan et al., 
2015). In these animals, growth rate can vary during development and is 
influenced by both intrinsic and extrinsic factors. For example, in humans, at the 
conclusion of the high pubertal growth period, the long bone growth plates are 
ossified thereby preventing additional increase in overall skeletal size 
(Kronenberg, 2003; Shim, 2015). Similar to mammals, holometabolous insects 
also exhibit determinate growth. In Drosophila, a larva increases its mass 200-
fold (70% of which occurs in the last larval instar) before terminating growth at 
pupariation (Church and Robertson, 1966). During the non-feeding pupal stage, 
the adult structures differentiate from larval imaginal tissue and there is no net 
  67 
increase in body mass. Thus, the final body size is set by the rate of larval growth 
and the timing of its termination...  
In recent years, numerous studies have centered on elucidating the 
molecular mechanisms that regulate hormonal activity during larval development 
in holometabolous insects to better understand how growth rate and duration are 
controlled (reviewed in (Boulan et al., 2015; Rewitz et al., 2013). In Drosophila, 
growth is largely regulated by the Insulin/IGF Signaling (IIS) and Target of 
Rapamycin (TOR) pathways, which are themselves regulated by different 
nutritional inputs. IIS is regulated by systemic sugar concentrations and TOR by 
circulating amino acid levels. Mutations that attenuate either pathway lead to 
slower growth rates resulting in diminutive animals with smaller and fewer cells 
(Böhni et al., 1999; Chen et al., 1996; Oldham et al., 2000; Rulifson et al., 2002). 
Conversely, activation of either pathway can lead to larger organs and cells if 
there are adequate nutrients (Goberdhan et al., 1999; Leevers et al., 1996; 
Stocker et al., 2003). Interestingly, systemic manipulation of IIS/TOR pathways 
typically leads to smaller or larger animals, with proportional effects on organ and 
appendage size (allometric growth) (Shingleton and Frankino, 2013; Shingleton 
et al., 2007).  
While IIS/TOR are central regulators of growth rate in holometabolous 
insects, the major regulator of growth duration is the steroid hormone 20-
hydroxyecdysone (20E) (reviewed in (Yamanaka et al., 2013a). During the final 
larval stage, a pulse of 20E extinguishes feeding, terminates growth and initiates 
  68 
pupariation. The timing of the 20E pupariation pulse is triggered, in part, by the 
neuropeptide prothoracicotropic hormone (PTTH) which in Drosophila is 
produced by the two pairs of neurons in each brain hemisphere that innervate the 
prothoracic gland (PG) (McBrayer et al., 2007; Shimell et al., 2018). PTTH binds 
to its receptor Torso and stimulates synthesis and secretion of ecdysone from the 
PG (Rewitz et al., 2009; Yamanaka et al., 2013a). PTTH production/release 
responds to a variety of environmental signals including nutritional status, light, 
and tissue damage as well as internal signals such as juvenile hormone (JH) to 
further tune the timing of pupariation (De Loof et al., 2015; Shimell et al., 2018; 
Yamanaka et al., 2013b).  
In addition to IIS/TOR signaling and steroid hormones, other signaling 
pathways have also been identified that affect final body mass and proportion 
scaling in both vertebrates and invertebrates. In particular, the TGFβ signaling 
pathway has known roles in controlling cell, tissue, and body size. TGFβ super-
family ligands signal by binding to a heterotetrameric complex of type I and type 
II serine-threonine receptor kinases (Heldin and Moustakas, 2016). Ligand 
binding triggers type II receptors to phosphorylate type I receptors, thereby 
activating its kinase. In canonical signaling, the activated type I receptor 
phosphorylates its major substrates, the R-Smads (reviewed in (Hata and Chen, 
2016). Once phosphorylated, R-Smads oligomerize with a co-Smads and 
translocate to the nucleus where together with other cofactors they regulate gene 
transcription (review in (Hill, 2016). The ligand super-family is broadly divided into 
  69 
two major sub-divisions based on phylogenetic and signaling analysis (Kahlem 
and Newfeld, 2009). These include the TGFβ/Activins, which in vertebrates 
signal through R-Smads 2/3, while the BMP/GDF-type factors signal through R-
Smads 1/5/8 (Macias et al., 2015).  
TGFβ family members contribute to tissue and body size growth by a 
variety of mechanisms. For instance, in mammalian mammary cells, TGFβ cell-
autonomously regulates cell size via mTOR during epithelial-mesenchymal 
transition (EMT) (Lamouille and Derynck, 2007). In addition, BMPs have been 
shown to control cell proliferation at the long bone growth plate and have been 
identified by genome-wide association studies as regulating human height 
(Hirschhorn and Lettre, 2009; Wood et al., 2014). Another particularly stunning 
example is Myostatin, a circulating Activin-type ligand, whose loss causes 
skeletal and muscle hypertrophy in vertebrates (McPherron and Lee, 1997; 
McPherron et al., 1997). TGFβ-type factors also affect the body size of 
invertebrates. For example, in C. elegans, a BMP-type ligand DBL-1, is secreted 
from neurons and signals via small (sma), a worm Smad, in the hypodermis to 
regulate expression of cuticle genes (Madaan et al., 2018; Tuck, 2014).  
To further explore how TGFβ ligands influence body size, we investigated 
the role of Drosophila Actβ in regulating these traits using both loss and gain-of-
function studies. In Drosophila, genetic studies as well as phylogenetic analysis 
suggests that Actβ signals via Baboon (Babo) and Punt, type I and type II 
receptors respectively, to phosphorylate dSmad2 (reviewed in (Upadhyay et al., 
  70 
2017). We find that canonical Actβ signaling through dSmad2 regulates adult 
viability, body size, and tissue scaling. Actβ mutants produce small larvae and 
pupae along with rare adult escapers. Compared to controls, these rare mutant 
adults exhibit small abdomens while other structures such as the head, thorax, 
leg, and wing are of relatively normal size. In larvae, muscle size is most 
profoundly affected while imaginal discs and the larval brain are of normal size. 
Furthermore, Actβ mutants have a slower overall growth rate, but show no 
defects in food intake.  Using tissue specific gain and loss-of-function, we 
demonstrate that motoneuron derived Actβ is required for proper muscle growth 
and adult viability. Conversely, hyperactivation of Activin signaling in muscles by 
overexpression of activated Babo produces a much larger animal with bigger 
muscles, but smaller imaginal discs. These observations demonstrate that 
muscle size can be perturbed without having proportional effects on the size of 
the imaginal tissues. Therefore, we suggest that either muscles and appendages 
do not typically coordinate their growth or that such coordination requires Actβ 
signaling. 
 
  71 
RESULTS 
Actβ is required for adult viability, normal body size, and correct tissue 
scaling  
Drosophila Actβ has been shown to be involved in a diverse group of 
developmental processes, including neuroblast proliferation, photoreceptor tiling, 
regulation of Akh signaling, inter-organ regulation of mitochondrial and hemocyte 
function (Makhijani et al., 2017; Song et al., 2017a; Song et al., 2017b; Ting et 
al., 2007; Zhu et al., 2008). However, in none of these studies was the lethal 
stage or the gross morphological phenotype carefully documented. To examine 
this issue, we initially characterized mutant phenotypes using the previously 
reported putative Actβed80 null allele (nonsense mutation) (Zhu et al., 2008). 
However, since the Actβ locus is on the fourth chromosome, additional recessive 
background mutations on the Actβed80 chromosome cannot be removed by 
recombination and therefore could complicate the phenotypic analysis of 
homozygous Actβed80 mutants. To resolve this issue, we generated several 
independent deletion alleles (Actβ4E, Actβ10E and Actβ 4dd) in the w1118 
background using the CRISPR/Cas9 system (Ren et al., 2013; Sebo et al., 
2014). All phenotypes initially described using Acted80 homozygotes were 
confirmed using different combinations of transheterozygous alleles to rule out 4th 
chromosome background effects.    
  72 
All examined Actβ mutant alleles are predominantly late pupal (pharate) 
stage lethal (Fig. 2-1 A and B).  Many of the pharates show limited movement 
inside the pupal case, but most never eclose. Manual cracking of the operculum 
allowed a small percentage (~1%) to escape and produce viable adults that 
exhibit severe locomotive defects, and held out immobile wings rendering them 
flightless (Movie available upon request). Despite these behavioral/physical 
defects, females could mate and produce offspring from wildtype males. Actβ 
mutant males were unable to produce progeny with either mutant females or 
wildtype females. Whether this is a behavioral issue (i.e. unable to initiate 
courtship behavior) or a fertility defect was not determined.  
In addition to pharate lethality, Actβ mutants exhibit a small body size at all 
stages of development.  Actβed80 homozygous pupae (mixed male and female 
populations) are 21% smaller by volume relative to w1118 or heterozygous pupae 
(Fig. 2-1C). Similar to the Actβed80 homozygous phenotype, all trans-
heterozygous combinations (Actβed80/4E, Actβ10E/ed80, Actβ10E/4E) are also 
significantly smaller (21%, 22%, and 26%, respectively) compared to w1118 
control (Fig 2-1D) indicating that the small pupal size is not caused by secondary 
mutations on the mutant chromosome. Taken together, these data indicate that 
Actβ is required to produce normal pupal volume and adult viability. 
Appendage size is proportionally scaled with body mass in Drosophila 
(Mirth and Shingleton, 2012). To examine if the adult body components of Actβ 
mutants are proportionally reduced, we collected 1 day old escaper males and 
  73 
females and measured various traits. We found that the Actβed80 homozygous 
male weights are reduced on average 28% compared to the control (Fig. 2-2 A, 
female 20% not shown). We next measured the abdomen, thorax, and 
prothoracic leg lengths, along with head projection area and wing surface area of 
Actβ mutant males and controls. Interestingly, the size of some adult structures 
of Actβ mutants are more severely affected than others (Fig. 2-2 B-L). The 
abdomen length in Actβ mutants is reduced by a much greater proportion, -24% 
(Fig. 2-2 D, F) than any other measured component: head projection area, -8% 
(Fig. 2-2 B, C), thorax length, -4% (Fig. 2-2 D, E), prothoracic leg length, -2% 
(Fig. 2-2 G, J), wing area -4% (Fig. 2-2 H, K). Using the wing trichome density as 
a proxy, we found no difference in cell size between Actβ mutants and the w1118 
control (Fig. 2-2 K, I, L), indicating that the minor reduction in wing size is likely 
caused by a subtle defect in cell proliferation at some time during development. 
 
Actβ disproportionately affects larval muscle and certain polyploid tissue 
sizes 
To understand the size discrepancy of adult structures in Actβed80 mutants, 
we examined directly the size of various larval tissues including brain, wing and 
leg discs, and body-wall muscles, and indirectly the sizes of several polypoid 
tissues including the fat-body, proventriculus, salivary and prothoracic gland cells 
using the size of the nucleus as a proxy for cell size.   
  74 
The most pronounced defect of Actβed80mutant larvae is exhibited by the 
body wall muscles which in males are reduced by 37% (Fig. 2-3 A-C), and 
muscle nuclear size by 53% (Fig. 2-3 D-F). The muscle size reduction is not 
caused by an earlier myoblast fusion defect since mutant muscles contain the 
same number of nuclei as wildtype (Fig. 2-9).  In contrast, neither the brain 
volume (Fig. 2-3 J, K) nor the 2-D projected surface area of the wing, leg, and 
haltere disc (Fig. 2-3 K-P) were significantly affected.  Interestingly, we note that 
the nucleus size of several other polyploid tissues including the fat body and the 
prothoracic glands are also significantly reduced, but to a lesser degree than the 
muscle nuclei (22%  for fat body, Fig. 2-3 G-I,  37% prothoracic gland vs 53%  
muscle Fig 2-10 G-I).  Curiously, the nuclear sizes of the cells within the 
proventriculus remained unchanged (Fig. 2-10 A-C) and the average salivary 
gland cell nuclear size actually increased. (Fig. 2-10 D-F).  We conclude that the 
small pupal volume and reduced escaper weights are primarily due to the 
disproportionate reduction in muscle size rather than alterations in mitotic tissue 
growth such as the brain and imaginal discs.  
 
Actβ mutants feed normally but grow slowly  
Body size is largely determined by two factors, the duration of growth and 
the growth rate, or some combination of the two parameters. In addition, a slower 
growth rate may reflect reduced food intake, diminished absorption of nutrients, 
  75 
or an alteration in metabolic flux. We examined several of these parameters to 
determine if they were altered in Actβ mutants. First, we measured the larval 
growth rate during the L3 period, when most of the larval growth occurs. At the 
start of the L3 stage, there is no difference in mass of the mutants versus the 
controls; however, over the course of 36 hours, a slower rate of mass 
accumulation becomes apparent such that, at the time when larvae begin to 
wander, the Actβed80 mutants weigh 18% less than w1118 controls (Fig. 2-4 A). 
This difference in growth rate likely accounts for a large portion of the reduced 
body size phenotype. To examine whether the diminished growth rate might 
reflect reduced food intake, we measured feeding rates of foraging early L3 
larvae by the mouth-hook contraction assay (Wu et al., 2003a; Wu et al., 2005). 
Surprisingly, we found no difference in the head contraction rates of the Actβ 
mutants (Fig. 2-4 B) suggesting that the slow growth rate of these mutants is not 
likely caused by reduced food intake, but instead may reflect an alteration in 
nutrient absorbance or dysfunctional metabolic flux.  
Next, to determine whether the small body size might also involve a 
reduced growth period, we measured the time to pupariation as well as the 
critical weight (CW), which is a nutritional checkpoint that ensures larvae have 
enough nutrient stores to produce viable adults (Nijhout and Callier, 2015). In 
both the control and Actβed80 mutant, starvation after just 2 hours into the L3 
stage blocks pupariation (Fig. 2-4 C). In the Actβed80 mutant, starvation beginning 
4 hours after L2/L3 ecdysis results in delayed pupariation, while starvation 12 
  76 
hours after L3 ecdysis results in no developmental delay, indicating attainment of 
CW. The w1118 control achieves CW 8 hours after L2/L3 ecdysis (Fig. 2-4 D,E).   
Given the four hour difference between the time the Actβed80 mutant and the 
w1118 control reach CW, and considering that Actβ mutants grow slower, we 
calculated that the weight at the time when CW is reached for Actβ mutants is 
similar to that of controls (0.88 mg for w1118 vs 0.84 mg for Actβed80,  Fig. 2-4 F). 
Therefore, we conclude that Actβed80 does not affect the CW checkpoint.  
Although the CW represents the lower threshold of mass necessary for 
pupariation without delay, body size can be altered by either a shorter or longer 
terminal growth period which occurs after CW has been reached (Nijhout and 
Callier, 2015).  Therefore, we also measured the total time to pupariation. We 
find that, although Actβed80 homozygous mutants grow slowly, they pupariate on 
average 4 hours earlier when compared to w1118 at 25°C. (Fig. 2-4 G). However, 
the Actβed80/+ heterozygotes also pupariate earlier than w1118 (Fig 2-4 G) 
suggesting either a haplo-insufficient effect of Actβed80 or that this phenotype is 
attributable to the genetic background differences between Actβed80 and w1118. To 
examine this issue, we repeated the experiment with two CRISPR alleles.  In this 
case, we find no difference in pupariation timing during the third instar stage 
between trans-heterozygous Actβ4dd/Actβ10E mutants or Actβ4dd/unc13 
heterozygotes compared to w1118 controls (Fig. 2-4 H). However, we also observe 
that certain allelic combinations such as w1118/unc13 wild-type controls and 
Actβ4dd/w1118 heterozygotes also pupariate 2 hours earlier than w1118 controls 
  77 
(Fig. 2-4 H). Therefore, we conclude that the slight timing differences reflect 
either differences in genetic background, slight differences in the duration of first 
and second instar growth, or the limits of timing resolution in this experiment and 
that Actβ loss does not substantially affect developmental timing. 
 
Overexpression of Actβ in its normal pattern produces larger and slower-
growing larvae. 
Since loss of Actβ results in small developmentally arrested pupae, we 
asked whether overexpression of Actβ in its endogenous pattern would have the 
opposite effect on pupal size, viability, and whether it might also affect 
developmental timing. For this purpose, we overexpressed Actβ using an Actβ-
Gal4 promoter enhancer line (Song et al., 2017a; Zhu et al., 2008). Relative to 
either the UAS-Actβ-3B2 or the Actβ-Gal4 controls, overexpression of Actβ (Actβ 
> Actβ-3B2) results in a significant increase in pupal volume and a delay in 
developmental timing (Fig. 2-5 A,B). Strikingly, pupariation is delayed over 20 
hours compared to either w1118 or Actβ mutants however, there is no change in 
viability (Fig. 2-5 B,C). Together, these data show that Actβ regulates body size 
and perhaps developmental timing in a dose dependent manner. 
 
  78 
Tissue and cell-type specific rescue experiments identify several potential 
sources of Actβ for controlling body size. 
To investigate how Actβ affects body size, developmental timing and 
viability, we first sought to determine if one or more cell types serves as the 
source(s) of the ligand that controls different aspects of the mutant phenotype. 
Several features of endogenous Actβ transcription have been previously 
described including expression in motoneurons, mushroom body neurons, 
peripheral neurons including multi-dendritic and chordotonal neurons, developing 
photoreceptors in the eye disc, and in midgut enterocytes (Gesualdi and Haerry, 
2007; Kim et al., 2014; Makhijani et al., 2017; Song et al., 2017a; Ting et al., 
2007; Ting et al., 2014; Zhu et al., 2008). We examined the Actβ expression 
pattern in the larvae by crossing an Actβ-Gal4 to UAS-cd8GFP or UAS-GFP. We 
also confirmed expression in particular cell types using RNA in situ hybridization 
(Fig. 2-11).  As previously described, Actβ is almost exclusively expressed in the 
central and peripheral nervous systems (Fig. 2-6 E).  More detailed examination 
reveals that in the central brain lobes, Actβ-Gal4>UAS-GFP is expressed 
strongly in mushroom body neurons and in a 14-cell cluster in the anterior medial 
region of each brain lobe (Fig. 2-6 A-A’’).  A subset of 7 cells within this 14 cell 
cluster also stain with α-Dilp5 (Fig. 2-6 A’), which marks the ~7 insulin producing 
cells (IPCs) (Brogiolo et al., 2001). In the ventral nerve cord, Actβ >Gal4 is 
expressed strongly in the motoneurons, marked by α-p-Mad (Fig. 2-6 G-G’’) 
  79 
(Marqués et al., 2002). We also see strong staining in all α-Dimm-marked 
neuroendocrine cells (Fig. 2-6 H-H”) (Park et al., 2008).  
Because of the possible developmental timing defects, we were 
particularly interested in whether Actβ is expressed in the neurons that innervate 
the ring gland (RG), the major endocrine organ of larvae, or in any of the RG 
cells themselves. We found strong expression in the corpus cardiacum (CC) cells 
that produce the hormone Akh which is involved in regulating sugar metabolism 
(Fig. 2-6 C-C’’, Fig 2-11 D). While we observed no expression in the cells of the 
prothoracic gland (PG), which produces the steroid hormone ecdysone 
(Yamanaka et al., 2013a), or in the corpus allatum (CA) which produces juvenile 
hormone (Riddiford et al., 2010), we did see signal in axons tracts that innervate 
each of these tissues (Fig 2-6 F-F’). The PG neurons produce prothoracicotropic 
hormone (PTTH) and innervate the PG portion of the ring gland to regulate 
ecdysone production (McBrayer et al., 2007; Siegmund and Korge, 2001). Co-
staining of Actβ>cd8GFP brains with α-PTTH reveals strong expression in the 
PG neurons (Fig. 2-6 B-B”). While we have no specific antibody that marks the 
CA neurons, the GFP positive innervations that we observe on the CA are highly 
suggestive that the CA neurons express Actβ (Fig. 2-6 F-F’). Actβ is also found in 
various other unidentified neurons within the central brain and ventral nerve cord. 
Outside the nervous system, we observe Actβ expression only in a limited 
number of enterocytes in the midgut (Fig. 2-6 D-D”) and non neuronal tissue 
expression includes the enteroendocrine cells (Fig. 2-6 D-D”, Fig 2-11 H ) as 
  80 
previously reported (Song et al., 2017a), and the ovariole follicle and border cells 
(Fig. 2-6 I-J, Fig. 2-11 G) and some tracheal cells. (Fig. 2-6 K, Fig. 2-11 F). Our 
observation that the rare escaper females are fertile suggests that Activin 
signaling in the follicle cells is either not required for full fertility or that its 
expression might be redundant with another activin like ligand such as Dawdle or 
Myoglianin. 
      
Motoneuron-derived Actβ regulates body size and viability 
To determine which Actβ-expressing cell types influence size and viability, 
we attempted rescue experiments using different tissue specific Gal4 drivers to 
overexpress the Actβ transgene in the Actβed80 mutant background. Actβed80 
mutants with one copy of either the UAS-Actβ or the various Gal4 transgenes 
served as negative controls.  Since overexpression of Actβ-GAL4 driving UAS-
Actβ is sufficient to increase body size (Fig. 2-5 A), here we asked whether it is 
able to rescue the small body size (pupal volume) and pupal lethality of Actβ 
mutants. Indeed, Actβ>Actβ in the mutant background is not only sufficient to 
rescue body size, but actually produces larger animals (47% bigger Fig. 2-7 A) 
similar to what we see upon overexpression in a wild type background (Fig. 2-5 
A). Overexpression of Actβ in its normal pattern also resulted in strong rescue of 
lethality (Fig. 2-7 B, 42.7% viability vs 1-4% viability of mutant controls; the test 
cross viability rate for w1118 is 73.8%, Fig. 2-7 B).  
  81 
To narrow down the relevant source of ligand that regulates each 
phenotype, we used increasingly restrictive (tissue specific) Gal4 lines to 
overexpress Actβ and then measured body size and viability. Overexpression of 
Actβ using the pan-neuronal driver, nrv2-Gal4, rescues both body size and adult 
viability (Fig. 2-7 C-D). Surprisingly, overexpression of Actβ from the 
motoneurons, OK371>GAL4, alone rescues both body size and viability (Fig. 2-7 
E-F). Interestingly, Actβ overexpression in Dimm+ neuroendocrine cells 
(C929>Gal4), also rescues both body size and viability (Fig. 2-7 G-H). Just like 
overexpression of Actβ from its endogenous sources, we also found that 
overexpression of Actβ in either motoneurons or neuroendocrine cells in wildtype 
animals also produces large adults (Fig. 2-12).  Lastly, overexpression of Actβ in 
only the IPCs (dilp2>Gal4), which makes up a much smaller subset of all 
neuroendocrine cells, does not rescue either phenotype (Fig. 2-7 I-J).    
The finding that expression in only the motoneurons rescues body size 
suggests that Actβ may be supplied directly to the muscles via the 
neuromuscular junctions. However, we also find that overexpression in 
neuroendocrine cells is sufficient to rescue body size, which suggests that Actβ 
may be able to function as a systemic endocrine signal and need not be directly 
delivered to the muscle via the neuromuscular junction synapse. Therefore, we 
asked if expression of Actβ from non-neuronal, but highly secretory tissues, was 
able to rescue various aspects of the null phenotype. Interestingly, expression of 
Actβ using the ppl-Gal4 (fat body and muscle) driver increases pupal volume 
  82 
beyond wild-type levels and partially rescues adult viability (Fig. 2-7 K and L).  
Overexpression in only the body wall muscles (MHC-Gal4) also increases body 
size beyond wild type levels, but does not rescue adult viability (Fig. 2-7 M-N). 
However, we note that overexpression of Actβ using either MHC-Gal4 or ppl-
Gal4 in a wild type background results in most animals dying as large oversized 
and curved pupae (Fig. 2-13). These phenotypes are likely due to hyperactivation 
of TGFβ signaling in the muscles because we observe a similar phenotype when 
a constitutively activated version of Babo is overexpressed in the muscles (Fig. 
2-13). Taken together, these results suggest that, although Actβ signaling in 
muscles is required for proper body size, too much signaling in muscles can be 
deleterious. We were not able to specifically test the ability of enteroendocrine-
derived Actβ to rescue mutant phenotypes, because overexpression of Actβ 
using the midgut enteroendocrine cell driver (EE-Gal4) (Song et al., 2017a) is 
lethal in both wild type and Actβ mutant backgrounds, likely due to 
overexpression in many cells besides enteroendocrine cells, including fat body, 
CNS and PNS (data not shown).  In summary, we conclude that since 
overexpression of Actβ from motoneurons or neuroendocrine cells rescues both 
body size and viability and can increase body size when overexpressed from 
these sources in wild type animals, they are likely the most important 
endogenous sources of ligand for viability and body size control.  
 
  83 
Motoneuron derived Actβ signals through the canonical Babo/dSmad2 
pathway to control muscle and body size.  
The rescue experiments described above suggest that either motoneurons 
or Dimm+ neuroendocrine cells, or both can produce enough Actβ to regulate 
body size. Since data from overexpression alone does not reflect the in vivo 
importance of various endogenous ligand sources, we sought a complementary 
set of loss-of-function data using tissue specific RNAi knockdown.  First, we 
tested all publicly available (TRiP, VDRC, and NIG) Actβ RNAi lines to 
phenocopy the Actβ mutant. Using the ubiquitous driver da-GAL4 to overexpress 
dicer2 along with the various Actβ RNAi lines, we find that only the TRiP stock 
(BDSC#29597) can phenocopy the small, dead pharates similar to Actβ null 
alleles (data not shown).  Most other lines produce viable flies of normal size 
suggesting that they are not very effective in knocking down endogenous Actβ. 
Both NIG lines (1162R-1 and 1162R-2) produce a more severe phenotype (early 
larval lethality) compared to the null suggesting it may have off-target effects.  
Using the TRiP 29597 RNAi line, we tested whether knockdown of Actβ in 
either all neurons, motoneurons or neuroendocrine cells alone phenocopies any 
aspect of null alleles. We find that knockdown in Dimm+ neuroendocrine cells 
(C929-Gal4) produces viable normal-sized flies (data not shown). In contrast, 
knockdown in all neurons (Elav>Gal4 Fig. 8A) or motoneurons (OK371-Gal4, Fig. 
2-8 A,B) completely phenocopies Actβ nulls giving rise to small, dead pharates 
with rare escapers that hold out their wings and have a slow gait (Movies 
  84 
available upon request). The OK371 driver is not expressed in the Dimm+ 
neuroendocrine cells (Fig. 2-14) leading us to conclude that the motoneurons are 
the major source of endogenous Actβ that regulates body size and viability.  
We next determined if motoneuron-derived Actβ signals to the muscle via 
the canonical Smad2 pathway. Canonical TGFβ signaling is mediated by the 
Activin receptor, Babo, and the signal transducer, dSmad2. In muscles, 
overexpressed Babo is localized to the postsynaptic neuromuscular junction, 
perhaps sensitizing the muscles to receive motoneuron derived Actβ (Kim et al., 
2014). Indeed, RNAi knockdown of Babo or dSmad2 in the body wall muscle 
results in smaller pupal volume (Fig. 2-8 C-D). Furthermore, on Western blots, 
we detect lower levels of phosphorylated dSmad2 in Actβ mutant carcass 
extracts (containing somatic muscle, cuticle and associated cells) compared to 
the w1118 control (Fig. 2-8 E).  Conversely, overexpression of Actβ in 
motoneurons both increases pupal/adult size (Fig. 2-12) and p-Smad2 levels in 
the carcass (Fig. 2-8 D-E), which is similar to overexpression of activated 
dSmad2 in the muscle, producing large larval muscles (Fig. 2-8 F-H) or 
overexpression of activated Babo or dSmad2 results in adult flies with extended 
abdomens (Fig. 2-15 A-C). Interestingly, the MHC>dSmad2(SDVD) animals with 
larger body size have slightly smaller wings, not larger wings as expected if 
organs are actively scaled to maintain size proportion between muscles and 
appendages (Fig. 2-15 D). 
 
  85 
DISCUSSION 
Identifying and characterizing how inter-organ signals regulate physiologic 
and metabolic homeostasis during development and adulthood is of central 
importance. Various types of inter-organ signals are also likely to be necessary 
for coordinating growth between organs during development to achieve proper 
body proportions (Droujinine and Perrimon, 2016). In this report, we demonstrate 
that Actβ is a key brain-derived factor that regulates somatic muscle size in 
Drosophila by signaling through the canonical Smad-dependent pathway. 
Furthermore, we find that disruption of Actβ signaling alters larval and adult 
organ allometry suggesting that Actβ might be a component of an inter-organ 
signaling pathway that helps coordinate muscle growth with appendage growth. 
 
Localized versus systemic effects of Actβ 
The question of whether Actβ acts locally or systemically via the 
hemolymph to target tissues is an important issue raised by our study and 
previous work (Song et al., 2017a; Song et al., 2017b). On the one hand, we find 
that Actβ is strongly expressed in most if not all neuroendocrine cells. We also 
find that overexpression of Actβ from these cells results in the rescue of mutant 
phenotypes and overgrowth of wild type animals indicating that direct tissue 
contact is not necessary for Actβ signaling to control muscle size. However, we 
also find that depleting Actβ expression in just the motoneurons phenocopies 
  86 
Actβ mutants while depletion in neuroendocrine cells does not do so, at least with 
the 929>Gal4 driver. Therefore, we conclude that, while high systemic 
concentrations of Actβ produced by overexpression is capable of regulating 
muscle growth, the endogenous systemic level supplied by the combination of 
the neuroendocrine and the enteroendocrine cells is not sufficient to do so.  
Whether local or systemic Actβ signaling is important in other contexts is 
less clear. Interestingly, Actβ has also been implicated in regulating hemocyte 
proliferation and adhesion within hematopoietic pockets localized on the larval 
body surrounding a number of peripheral neurons that express Actβ including da 
and chordotonal peripheral neurons (Makhijani et al., 2017).  In contrast, 
enteroendocrine derived Actβ is able to affect AKH receptor levels in the fatbody 
to regulate glycemic index on a high sugar diet (Song et al., 2017a). In addition, it 
has been reported that upon mitochondrial perturbation, muscle-derived Actβ 
signals to the fat body to regulate triglyceride levels (Song et al., 2017b). In either 
case these observations raise the question: what dictates the requirement of a 
local versus a systemic signal for Actβ function?  In the muscle motoneuron 
synapses and hematopoietic pocket paradigms, there may be physical barriers 
that help concentrate ligand from a local source to levels sufficient to produce a 
response. In the case of muscles, motoneuron synapses are embedded within 
the muscle fiber (Prokop, 2006; Prokop and Meinertzhagen, 2006) and therefore 
delivery of Actβ directly to the NMJ via the synapse likely provides a highly 
effective signal, especially since its receptor Babo is also highly concentrated at 
  87 
the postsynaptic NMJ (Kim et al., 2014).  This possibility might also account for 
the discrepancy between our findings (Fig. 2-11) that muscles do not express 
Actβ under normal conditions, while mitochondrial perturbations in muscle 
appears to release Actβ for signaling to the fat body (Song et al., 2017b).  
Perhaps disturbing mitochondrial function in muscle disrupt synaptic structure 
such that Actβ is liberated from defective NMJ synapses.  Likewise, the 
hematopoietic pockets might provide a similar restricted niche-like signaling 
environment that is able to modulate hemocyte proliferation and adhesion. These 
types of physical constraints may limit the ability of endogenous circulating Actβ 
to produce sufficient levels of signaling at these locations, except under 
overexpressed conditions. 
Another factor influencing the cellular response to Actβ levels is the 
composition of the surface receptors. The babo locus produces three receptor 
isoforms that only differ in the extracellular ligand binding domain, and each likely 
has a different affinity for the three Activin-like ligands (Jensen et al., 2009; 
Upadhyay et al., 2017). Therefore, the complement of receptor isoforms on a 
cell’s surface is apt to determine the sensitivity of the cell or tissue to Actβ 
signals. 
  
  88 
Mechanisms of Actβ control of tissue size  
The molecular mechanism(s) by which Actβ affects tissue growth are 
unclear. The most well characterized factors that regulate insect body size are all 
systemic signals such as juvenile hormone, ecdysone and the IIS/TOR pathways 
(Boulan et al., 2015; Koyama and Mirth, 2018; Mirth and Shingleton, 2014; 
Rewitz et al., 2013). For example, Ptth mutants delay ecdysone accumulation 
allowing larvae to grow for an additional 24 hours ultimately leading to larger flies 
(Shimell et al., 2018).  In this report, we demonstrate that Actβ, although it is 
expressed in the PTTH-producing neurons, does not appear to affect ecdysone 
signaling since Actβ loss affects neither critical weight nor developmental timing.  
Interestingly, we also see Actβ positive innervation of the CA organ which 
produces juvenile hormone (JH), and lowering JH levels in Drosophila leads to 
production of smaller flies by slowing the overall growth rate (Mirth et al., 2014; 
Riddiford et al., 2010). Since we also observe a slower growth rate in Actβ 
mutants it is possible that Actβ might work to slow growth via reduction of JH 
signaling. However, given the strong expression of Actβ in all Dimm+ 
neuroendocrine cells which secrete numerous peptides that regulate many 
aspects of behavior and metabolism including insulin, many other mechanisms 
must be considered for slowing growth.  While food intake does not seem to be 
altered in Actβ mutants, it is possible that nutrient absorption or metabolic flux is 
disrupted. The latter possibility is particularly attractive since we see strong 
expression of Actβ in the CC organ, which produces the Drosophila glucagon-like 
  89 
hormone (Akh), and in the insulin producing cells (IPCs) in the brain.  As 
previously noted, Actβ has been implicated in regulating AkhR levels in the fat 
body (Song et al., 2017a) and perhaps it may also influence Akh synthesis or 
release.  Furthermore, Dawdle, another Drosophila Activin-like ligand that also 
signals through dSmad2 has been previously shown to regulate metabolism and 
carbohydrate utilization (Chng et al., 2014; Ghosh and O’Connor, 2014). 
Therefore, Actβ signaling through dSamd2 may also regulate global 
carbohydrate synthesis or aspects of metabolism to adjust the larval growth rate. 
Regardless of how overall growth defects occur, it is important to 
remember that not all larval tissues respond equally to Actβ. The brain and 
imaginal discs, for example, are of normal size while fat body and muscle are 
significantly smaller. In addition, the size and viability defects can be largely 
rescued by expression of Actβ solely in motoneurons. Therefore, it seems 
unlikely that a primary defect in systemic levels of insulin or Akh would account 
for the tissue specific responses. Rather, it is likely that alterations in muscle 
metabolism and perhaps factors secreted by muscles could account for the small 
muscle/body size. 
  
Larval versus Adult requirements for Actβ 
The requirement of Actβ for adult eclosion raises several issues. The first 
is whether the low eclosion rate is primarily a muscle defect or a neuronal 
  90 
problem since both must be coordinated to produce the complex set of motor 
behaviors required for eclosion. Interestingly, ablation of Dimm+, Eclosion 
hormone (EH) producing neuroendocrine cells (Park et al., 2008), results in a 
defective eclosion motor program, which involves a series of coordinated head, 
thorax, and abdominal muscle contractions that ejects the animal through the 
operculum and out of the pupal case (McNabb et al., 1997). It may be that the 
small adult muscles lack the power to properly execute the eclosion motor 
program. In addition, the small muscle phenotype may also partially explain why 
the Actβ mutant adult escapers walk slowly and cannot move their wings. 
However, this must be reconciled with the observation that Actβ mutant larvae 
exhibit no obvious defect in locomotion, even though they have a similar 
proportional reduction in overall body and muscle size. 
Improper synaptic development or NMJ function could also potentially 
account for adult locomotion defects. However, we have previously shown that, 
at least in larvae, the NMJ size and bouton number are not affected in babo and 
dSmad2 mutant larvae when normalized to the smaller muscle size (Kim et al., 
2014). Nevertheless, we did uncover a number of electrophysiological alterations 
including a decrease in the number and frequency of miniature excitatory 
potentials and a depolarized muscle membrane resting potential, both of which 
were primarily attributed to defective Actβ signaling in muscles (Kim et al., 2014). 
Despite these defects, the large action potentials in babo and dSmad2 mutants 
are relatively normal and, as described, there are no obvious larval locomotion 
  91 
defects (Kim et al., 2014). Since adult muscles are formed de novo during 
metamorphosis, it is possible that during this time more extreme defects in 
muscle or neuron physiology develop in Actβ mutants, perhaps leading to a more 
strongly depolarized muscle, for example, that would interfere with proper muscle 
function. 
The motoneuron source of Actβ also raises questions concerning whether 
Actβ production/release is muscle/neuron activity dependent. We find that 
overexpression of Actβ in motoneurons can produce bigger muscles, but whether 
increased muscle activity also accompanies higher Actβ expression/secretion 
triggering increased muscle growth is an interesting issue to address. We note, 
however, that adult muscles, which develop during the immobile pupal stage, are 
also likely smaller than wild type in Actβ mutants suggesting that significant 
muscle activity is not likely required for Actβ release. 
  
Body-appendage scaling 
One of the more novel features of the Actβ null phenotype is the 
disproportionate effect it has on muscle size compared to other tissues. One 
might expect that evolutionary pressures fine tune mechanisms to coordinate 
muscle size with the size of the appendage that it moves. This is perhaps 
especially true in winged insects where flight muscle and wing size should be 
coordinated to produce efficient flight. Such coordination between wing and body 
  92 
size in response to environmental perturbations has been best studied in 
Manduca sexta (Nijhout and Callier, 2015; Nijhout and Grunert, 2010). In this 
insect, nutritional restriction can result in as much as a 50% reduction in body 
size, with the wing scaling proportionally and containing half as many cells 
(Nijhout and Grunert, 2010). This scaling mechanism utilizes a shift in the 
amplitude and kinetics of steroid hormone production during the last instar stage. 
Since this mechanism involves systemic factors that adjust the growth rate of the 
whole body, presumably affecting muscles and discs simultaneously, it does not 
really address whether specifically perturbing muscle growth can directly or 
indirectly affect growth of the wing or other appendages.  
In Drosophila, alteration in the growth properties of one imaginal disc 
perturbs growth of other wild type discs in a coordinated manner so that adults 
emerge with properly proportioned structures (Simpson and Schneiderman, 
1975; Simpson et al., 1980; Stieper et al., 2008). Once again, the inter-organ 
signaling mechanism involves alteration in the levels of systemic hormones 
(Gokhale et al., 2016; Mirth and Shingleton, 2012; Parker and Shingleton, 2011). 
In these reports, is not clear whether muscle size was also altered to produce 
isometric scaling between it and the imaginal discs. However, it is interesting to 
note that growing Drosophila at low temperatures produces hyperallometric 
scaling where the wing size is disproportionally larger relative to body size 
(Shingleton et al., 2009). Since we observe similar phenotypes in Actβ mutants 
grown at normal temperatures, it is intriguing to speculate that Actβ signaling 
  93 
might mediate hyperallometric scaling between wing and body in response to 
temperature. 
The only other report that we are aware of where Drosophila larval muscle 
size was specifically manipulated, and the effect on growth of other tissues 
examined, involved genetic alteration of insulin signaling (Demontis and 
Perrimon, 2009). Similar to our analysis of Actβ, the level of insulin signaling in 
muscle is directly correlated with muscle, appendage, and overall animal size. 
Nevertheless, our findings for Actβ show several notable differences. First, 
insulin gain-of-function signaling in muscle lead to larger bodies and larger wings 
(Demontis and Perrimon, 2009), while we find that increased Actβ signaling in 
muscles results in larger bodies, but slightly smaller wings. In the insulin loss-of-
function case, both muscles and wings were smaller, the latter due to a reduction 
in cell size not cell number. However, in the case of Actβ mutants, we see only a 
4% decrease in wing size with no change in cell size. In both cases, the effect on 
muscle size appears to be much more dramatic than the effect on appendage 
size. Therefore, if a scaling mechanism exists, then either insulin or Actβ loss 
disrupts it, or it is not isometric as is found for the nutrient-dependent body-wing 
scaling response in M. sexta. The general similarity in phenotypes produced by 
insulin or Actβ signaling suggests that Actβ may exert its effect on muscle and 
body size, in part, through the insulin signaling pathway, a possibility that we are 
currently exploring. 
  
  94 
TGFβ control of body size in other animals 
TGFβ regulation of body or muscle size has been reported in both C. 
elegans and mammals. In C. elegans, BMP-type factors are also secreted from a 
specific set of neurons and appear to act systemically to regulate the size of the 
hypodermis through a canonical Smad dependent pathway (Tuck, 2014). In fact, 
the term Smad is a compound word derived from the C. elegans gene sma 
meaning small, and the Drosophila gene mad (mothers against dpp) which were 
the founding members of the Smad family of TGFβ signal transducers (Derynck 
et al., 1996). Recently, many transcriptional targets for the Sma factors in C. 
elgans have been identified, among which are several collagens that are major 
structural components of the hypodermal body-wall (Madaan et al., 2018). 
Hence, we speculate that one set of targets for both Actβ and insulin signaling in 
the Drosophila muscle could be structural proteins that build muscle. It is also 
possible that target gene expression is indirectly regulated by DNA copy number. 
In Drosophila, larval and adult muscle are polyploid tissues where DNA content is 
controlled by endocycling.  Both Actβ (this report) and insulin signaling (Demontis 
and Perrimon, 2009) appear to regulate nuclear size in many polypoid tissues, 
possibly indicating that control of the endocycle maybe the primary mechanism 
regulating tissue size.  However, at least in Actβ mutants not all polyploid tissues 
show regulation in the same direction, i.e. muscle, fatbody and the prothoracic 
gland all show smaller nuclei while the salivary gland has larger nuclei. Whether 
  95 
systemic Actβ signaling is directly regulating size of polyploid tissues or acts 
indirectly through a muscle-derived myokine needs to be determined. 
In mammals, the best characterized example of a TGFβ-type factor that 
regulates body and muscle size is provided by Myostatin (Mstn). Loss of Mstn 
was discovered to cause the muscle overgrowth phenotype of Belgian blue cattle 
and subsequent work in many other species including humans confirmed that 
Mstn is a negative regulator of muscle mass (McPherron and Lee, 1997; 
McPherron et al., 1997). Mstn mutant muscles have both an increase in myofiber 
number (Matsakas et al., 2010; Trendelenburg et al., 2009) as well as myofiber 
size (Elashry et al., 2009; McPherron and Lee, 1997). The molecular basis for 
the phenotype appears to be an alteration in protein homeostasis, where 
proteasome and autophagic degradative capacity is reduced relative to protein 
synthesis (Lee et al., 2011; Lokireddy et al., 2012). Mstn signals through 
Smads2/3 and is therefore considered to be within the TGFβ/Activin subgroup in 
the TGFβ superfamily. Additional studies of Activin ligands themselves suggest 
that that they also act as negative regulators of muscle mass similar to Mstn 
(Zhou et al., 2010). Furthermore, studies on the role of BMP signals in muscle 
size control suggest that they function as dominant positive regulators of muscle 
mass by promoting protein synthesis instead of breakdown (Sartori et al., 2013; 
Winbanks et al., 2013). 
Our present work shows that in Drosophila, Actβ is a positive regulator of 
muscle mass, by affecting myofiber size not number.  It is worth noting that 
  96 
Drosophila has a close Myostatin homolog that is called myoglianin (myo) and 
recent studies suggest that loss of myo in muscle produces larger fibers similar 
to the vertebrate homolog (Augustin et al., 2017). How Actβ and Myo interact will 
be interesting to examine as will the role for BMPs in Drosophila muscle size 
determination. Lastly, the question of whether Mstn loss in vertebrates affects 
scaling of other tissues is largely unexplored although it does appear that bone 
density is increased in myostatin mutant animals (Elkasrawy and Hamrick, 2010). 
Additional studies of how local versus systemic roles of TGFβ ligands might 
affect growth and scaling between tissues and organs in vertebrates should be 
enlightening. 
 
MATERIALS AND METHODS 
Fly lines 
For overexpression experiments single copies of Gal4 and UAS 
transgenes were used. Actβ-Gal4 and UAS-Actβ (3B2) were previously 
described (Zhu et al., 2008).  C929-Gal4, dilp2-Gal4, Elav-Gal4, Mef2-Gal4, 
MHC-Gal4, Nrv2-Gal4, OK371-Gal4, ppl-Gal4, UAS-dicer2, UAS-cd8::GFP, and 
UAS-Actβ RNAi Ok6>Gal4 were all from the Bloomington stock center. UAS-
babo RNAi, UAS-dSmad2 RNAi, were from O’Connor lab stocks. (details of 
construction available upon request). UAS-dSmad2SDVD (constitutively activated 
dSmad2) was previously described (Gesualdi and Haerry, 2007). 
  97 
The Actβed80 allele is an EMS-induced substitution leading to a premature 
stop codon and presumed to be a null mutation (Zhu et al., 2008). The 
chromosome carrying the Actβed80 allele (fourth) also contains a variegating w+ 
transgene (P{hsp26-pt-T}39C-12, FlyBaseID= FBti0016154) inserted between 
Hcf and PMCA (John Locke, personal communication). This w+ transgene 
causes red speckles with dominant inheritance in an otherwise w- background.  
Actβ4E and Actβ10E and Actβ4dd were all generated using the 
CRISPR/Cas9 system. Two guide RNAs were cloned into the BbsI site of pU6-
BbsI-chiRNA plasmid (obtained from Addgene) and injected by Best Gene into 
w1118; PBac{y[+mDint2]=vas-Cas9}VK00027 on chromosome 3 (Bloomington 
Stock Center #51324). The following guides were used to target the genomic 
locus, guide 1: 5’-GGGTTGTGGAAATGACTTCC-3’, guide 2: 5’-
GCGATTGCACGGGCTCTTTT-3’. G0 male flies were backcrossed to a balancer 
stock (CiD/unc13-GFP) to isolate w1118;;;Actβ?/unc-13-GFP stocks. To identify 
new Actβ alleles, DNA from homozygous (non-GFP) larvae was used to PCR 
amplify the genomic region flanking the CRISPR target sites using the following 
primers (FWD: 5-CTGCTGCAACAGCCTTGGCTCCC-3; REV: 5-
GGGGCGCAACACGGTCGCATTCC-3). 
Line 4E and 4dd are independent ~3 kb deletions that remove that remove 
exons 2 and 3.  Line 10E is a ~1.3 kb deletion that removes exon 4 and 5.  Exact 
deletion junction sites are available upon request. 
  98 
Rearing Conditions 
Eggs were collected over a 2-3 hour time period on apple juice plates 
inoculated with yeast paste and aged until hatching into first instar larvae. Larvae 
of the desired type were then transferred to vials containing standard cornmeal 
food (Bloomington recipe) and incubated at 25°C in a 12 hour light/dark cycle 
until scoring. Animals were transferred to vials at a low density (30 or 40 per vial) 
to prevent crowding affects. 
Size measurements of larval tissues and nuclei 
To measure size of larval organs, tissues were prepared using standard 
protocols for immunohistochemistry (see below). To measure size of larval body 
wall muscles, larval fillets of late wandering L3 larvae were prepared, and the 
surface area of muscle #6 of the A2 segment was measured in FIJI by outlining 
the muscle segment using the free-hand selection tool. Larval brains were 
stained with DAPI and rhodamine-phalloidin and placed onto a glass microscope 
slide between two #2 coverslips that acted as a bridge to prevent deforming the 
shape of the brain lobes. Confocal Z-stacks of the entire lobe were captured, and 
manual 3D segmentation using ITK-SNAP (PMID: 16545965) was used to 
measure lobe volume. Imaginal discs were stained with DAPI, imaged using 
confocal microscopy, and then maximum intensity projections were generated 
and processed in FIJI using the threshold and measure functions to obtain a 2D 
area of each disc.   For fat body, proventriculus, muscle salivary and the 
  99 
prothoracic glands, tissue was stained with DAPI and rhodamine-phalloidin and 
then Z stacks obtained.  Nuclear size was measured using FIJI (Schindelin et al., 
2012) at the sections where nuclei were largest. 
Pupal Volume determination 
Pupal volume was calculated from the length and width of individual 
pupae assuming a prolate spheroid shape [V = (4/3) π (width/2)2 (length/2)] 
(Demontis and Perrimon, 2009). Pupal length was measured from the anterior tip 
midway between spiracles to the base of the posterior spiracles. Pupal width was 
measured at the mid-length of the pupae. 
Measurement of Adult appendage sizes 
Adult specimens were fixed in 95% Ethanol. Structures were dissected 
and mounted in Canadian Balsam (Sigma, C1795) and Wintergreen oil (Sigma, 
M2047) solution (50:50). To measure size (length or area) of adult body parts 
images were processed in FIJI using either the free-hand or polygon tool 
(illustrated by red lines in Fig. 2-2).  
Developmental Timing and Growth Assay 
To measure developmental timing, flies were transferred to a constant 
light environment for at least 2 days prior to egg lay and all subsequent assays 
were carried out under constant light conditions to avoid circadian rhythms. Eggs 
were collected on apple juice plates with yeast paste for two hours.  The next 
day, early L1 larvae were transferred to standard cornmeal food with yeast paste.  
  100 
For Actβed80/Actβed80 mutants the time to midpoint of pupariation was measured.  
For the CRISPR alleles, an additional synchronization step was employed. After 
~48 hours of growth, 20-30 synchronized L2-L3 ecdysing larvae were transferred 
to cornmeal food without yeast paste to measure time to pupariation. Pupariation 
was scored every 2 hours by monitoring for anterior spiracles eversion and larval 
movement.  The half point is the time it takes for half of the population to 
pupariate, which is calculated using a simple linear regression.  
To measure growth rate, L3 larvae were cultured for appropriate times 
after L2-L3 ecdysis, washed in water and weighed individually on a Mettler 
Toledo XP26 microbalance. For adult mass, groups of 8-10 animals were 
weighed on the microbalance. 
Statistics 
Data were analyzed using either Graph Pad – Prism or R-studio. A single 
test variable was compared to a single control using a Welch Two Sample t-test. 
Multiple test variables were compared to controls using a one way ANOVA 
followed by Tukey’s multiple comparison test. For rescue experiments with two 
controls and one test cross, the test cross must be significantly different in the 
same direction (e.g. larger) to be considered a significant result. Where the test 
cross was reported to be x units different than the controls, the different was in 
reference to the control with smaller variation. P values designation: ns= not 
significant, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. 
  101 
Immunohistochemistry 
Wandering third instar larvae were rinsed, dissected, fixed in 3.7% 
formaldehyde in PBS for 25 minutes, and then washed three times in PBS-
(0.1%) TritonX-100. Samples were incubated with primary antibody overnight at 
4°C followed by secondary antibodies for 2 hours at 25°C. Tissues were mounted 
in 80% Glycerol.  The following stains and antibodies were used: Rhodamine-
phalloidin (Molecular Probes R415), α-Dachshund (DSHB, mAbdac2-3), α-PTTH 
(guinea pig) a gift from P. Leopold, α-p-Mad (Eptitomics), α-DIMM a gift from P. 
Taggert. 
Microscopy 
Confocal images were generated using a Zeiss Axiovert microscope with 
a CARV attachment or Zeiss LSM710. Pupae, adult heads, and body were 
imaged live with Zeiss Stemi stereo microscope using a 1X objective. Adult wings 
and legs were imaged using Nikon Optiphot light microscope with a 4X objective. 
Trichomes were imaged using a 40X objective. 
Western Blots 
L3 larvae were dissected and all organs were removed from the carcass 
samples. Carcass samples were lysed with reducing gel loading buffer. Bands 
were resolved on 4-12% gradient gels (Invitrogen), and transferred to PVDF 
membrane (Biorad). Membrane blocking and antibody incubation were 
performed using standard protocols for ECL detection. α-pSmad2 (CST, 138D4) 
  102 
and α-tubulin (Sigma, T9026) were used at 1/1000 dilutions. Bands were 
visualized using Pierce ECL Western Blotting Substrate (#32209). 
  
  103 
CHAPTER II FIGURES 
 
Figure 2-1. Actβ null mutants exhibit a small body size and late pupal 
lethality.  
(A,B)  Most Actβ mutants die as late pharates in the pupal case with between a 
1-4% escaper rate. Heterozygotes and w1118 controls exhibit ~80% viability.  (C) 
Pupal volume of Actβed80  (mixed male and female pupa) null mutants (orange 
triangles, 1.55 mm3) are ~20% smaller than heterozygous individuals  (yellow 
triangle, 1.97 mm3) and w1118 controls (grey squares, 1.97mm3) (D) Pupal 
volumes of other Actβ trans-heterozygous mutant combinations  show similar 
decreases in pupal volume. M is the sample mean shown above each data set, N 
is sample size for pupal volume and R is number of replicates for each genotype 
(A,B), each replicate consists of 30 - 40 larvae. Means indicated by yellow 
diamond, ± SEM.  
  104 
 
Figure 2-2. Actβ mutant adult escapers have a disproportionately smaller 
abdomen compared to head, thorax, leg, or wing. 
(A) Actβed80 mutants that eclose as adults weight ~ 28% less than vs w1118 
controls (n = 3-4 groups containing 9-10 individuals).  (B-C) Heads of mutant 
males are ~8% smaller, (scale 500µm, n>30). (D) Thorax and abdomen (F) are 
~4% and ~24% smaller respectively, (scale 500µm, n = 23). (G,J) Legs and 
wings (J,K) of mutants are ~2% and ~4% smaller respectively (scale 500µm, n = 
22 – 46).  (I, L) trichome density in the adult wing shows no difference in cell size 
(scale 50µm, n = 13 – 16). Means ± S.D. are shown. 
  105 
 
Figure 2-3. Actβ disproportionately affects the size of larval body wall 
muscles and fat body nuclei size.  
Late wandering L3 larvae were dissected and the size various tissues 
determined. (A,B) Larval fillets were stained with rhodamine-phalloidin and 
imaged in the muscle plane. Double headed arrows mark the extents of a larval 
segment photographed at the same magnification (scale bar = 500µm).  Note 
that approximately 3 segments of Actβ mutant muscles occupy the same area as 
2 wildtype segments.  (C) Loss of Actβ results in a 37% decrease in the surface 
area of muscle #6 from the A2 segment compared to control (n = 7 – 12). (D - F) 
Muscle nuclei (DAPI, green) of Actβ mutants are 53% smaller (scale bar =50µm, 
n > 250) than controls. (G – I) Fat body nuclei (DAPI, gray) of Actβ mutants are 
22% smaller than control (scale bar = 50µm, n > 200).  (J – K)  3D reconstruction 
of larval brains stained with DAPI and rhodamine-phalloidin, the volume of each 
brain lobe was measured separately and Actβ mutants  showed no significant 
difference of brain size compared to control (n > 30). (L-P) Wing, leg, and haltere 
imaginal discs (DAPI green, phalloidin magenta) of Actβ mutants are the same 
size as controls, scale 100µm, (n > 20 in each group). Means ± S.D. are shown. 
  
  106 
 
Figure 2-4. Actβ mutant larvae grow slowly but do not exhibit differences in 
Critical Weight or Developmental timing.    
(A) wet weight of L2/L3 synchronized larvae were measured. No difference in 
weight of Actβ mutants (blue circles/line) and w1118 controls (black triangles/line) 
early but after 36 hours weigh ~18% less than controls, (n = 8 – 10 per group). 
(B) Actβ (squares) mutants feed at the same rate as controls (circles) (n = 16 – 
22). (C) Actβ mutants  are more sensitive to starvation in the early L3 stage than 
controls (D, E) The critical weight checkpoint  was determined by identifying the 
time at which  starvation does not delay pupariation. Actβ mutants reach the CW 
checkpoint 4 hours after controls.  (F) Comparing the larval mass when larvae 
  107 
reach their respective CW checkpoints shows that Actβ (at 12 hrs AL2/3) weight 
the same as controls (at 8 hrs AL2/3).  (G) Developmental timing analysis of 
when 50% of the population have pupariated of Actβ80 mutants and 
heterozygotes vs controls, shows that both mutants and hets pupariate ~5 hrs 
earlier mean ± SEM).  (H)  Developmental timing analysis of CRISPR alleles and 
various heterozygous controls. Actβ4dd/10E mutants do not develop faster than the 
w1118 control, however both Actβ4dd/w1118 and unc13GFP/w1118 hets develop ~3 
hrs faster mean ± SEM than either w1118 or the Actβ4dd/10E mutant combination. 
Unless indicated mean ± SD is shown. 
  
  108 
 
Figure 2-5. Actβ overexpression increases body size and delays 
developmental timing.  
(A) Expression of UAS-Actβ using Actβ-Gal4 significantly increases pupal 
volume. (B) Actβ>Actβ animals pupariate about ~20 hours later than controls. (C) 
Adult viability is not significantly impacted in Actβ>Actβ animals. M=mean, 
N=number of individuals, R= number of groups containing 10-30 larva).  
  
  109 
Figure 2-6. Analysis of Actβ-GAL4 driver expression pattern (green) in L3 
larvae.  
(A-A’’) Actβ-GAL4 is expressed in the Insulin Producing Cells in the central brain, 
marked with α-Dilp5 (red). (B-B’’) Actβ reporter is expressed in the cell bodies of 
PTTH neurons (α-PTTH, red) in the central brain. (C-C’’) Actβ reporter is 
expressed in AKH producing (α-AKH, red) neurons. (D-D’’) Actβ-Gal4-driven 
GFP is expressed in midgut enteroendocrine cells (Blue DAPI) (E) An intact L1 
larvae, Actβ-Gal4-driven GFP is expressed in both the central and peripheral 
nervous systems.  (F,F’) Actβ-Gal4-driven GFP is found in PTTH synaptic 
boutons (red) on the PG (thicker dotted line, white arrows) as well as unique 
boutons in the CA (finer dotted line, yellow arrows). PG= prothoracic gland, CA= 
  110 
corpus allatum.  (G-G”) Actβ reporter drives expression in the motor neurons 
(marked with α-pMad red) in the ventral nerve cord (white arrows highlight two 
individual motor neurons.  (H-H”) Actβ reporter is expressed in neuroendocrine 
cells (α-DIMM, red) in the ventral nerve cord  (I ) Actβ-Gal4-driven GFP is found 
in follicle cells and the border cells during egg development. (K) Actβ-Gal4-driven 
GFP is found in certain tracheal associated cells and (L) in differentiating 
photoreceptor cells in the eye disc. 
  
  111 
 
  112 
Figure 2-7. Expression of Actβ from specific cell types differentially 
rescues Actβ mutant phenotypes.  
The first two groups in each panel are controls in which Actβ mutants contain one 
copy of either the GAL4 driver (indicated on the left side of each panel row) or 
the UAS Actβ transgene. The third group in each panel is the testcross, and the 
last group in each panel is the w1118 control. All GAL4 drivers (except dilp2-
GAL4) used to overexpress Actβ rescue body size phenotype (A, C, E, G, K, M). 
Overexpressing Actβ in neuronal tissues (D, F, H) completely rescues adult 
viability phenotype, and partially rescue when overexpressed in body wall 
muscles using MHC-GAL4 (L). ANOVA was used to determine statistical 
significances between genotypes with one copy of either Gal4 or UAS 
transgenes in an Actβed80 homozygous background compared to animals with 
both Gal4 and UAS transgenes in an Actβed80 homozygous background. w1118 is 
the wild-type control and was reared side-by-side in each case. M=mean, 
N=number animals, R= repetition number (10- 30 animals per rep). 
  
  113 
 
Figure 2-8. Motor neuron derived Actβ signaling through Babo and dSmad2 
controls body size.  
(A). Knockdown of Actβ using a pan-neuronal driver (elav-Gal4) with UAS-dicer2 
reduces pupal volume  (B) Motor neuron knockdown of Actβ using OK371-Gal4 
to also reduces pupal volume. (C) Knocking down the Actβ receptor baboon or 
the signal transducer dSmad2 (D) in muscles using MHC-GAL4 with UAS-dicer2 
reduces pupal volume.   M=mean, N=number (E) Actβ mutants have lower levels 
of p-dSmad2 (E, lane 1 vs 2) in carcass tissue lysates (cuticle, skeletal muscle). 
While overexpressing Actβ in motor neurons leads to increased level of dSmad2 
compared to controls (E, lanes 3-5) Anti-tubulin staining serves as a loading 
  114 
control. (F – H) Overexpressing activated dSmad2 (dSmad2CA) in the muscles 
using MHC-GAL4 increases muscle size by ~20%. 
 
Figure 2-9 Actβ does not affect muscle nuclei number 
3rd instar larvae were filleted and stained with DAPI (blue) and phalloidin (red). 
(A) Quantification of the number of nuclei in muscle #6 and #7 for w1118 controls 
and Actβed80mutants shows no significant difference. (B) Representative image 
of muscle fiber (red) with stained nuclei (blue) for w1118 controls and 
Actβed80mutant. Each image has muscle #6 (left) and muscle #7 (right) outlined 
with dashed line. N is shown for each group in A, ns = not significant 
  
  115 
 
Figure 2-10 Size of various polyploid nuclei in Actβ mutants.  
Proventriculus, salivary gland, and the prothoracic gland of 3rd instar wandering 
larvae were dissected, stained with DAPI (green, A, B, D, E; grey, G, H) and 
phalloidin (magenta, A, B, D, E) to quantify nuclei size. (A-C) The nuclei of the 
cells of the proventriculus in Actβed80mutants are 10% larger. (D-F) The nuclei of 
the salivary gland cells in Actβed80mutants are 48% larger. (G-I) The nuclei of the 
prothoracic gland cells are -32% smaller. Size of scale bar indicated on the 
image. For each group n = 60-170. 
  
  116 
 
Figure 2-11 RNA in situ hybridization of Actβ shows expression in various 
tissues 
(A-I) Actβ is expressed in cell body of motoneurons (A) and neuroendocrine cells 
(B) in the ventral ganglion of 3rd instar larval CNS, (C) eye disc, (D) CC cells, (F) 
trachea, (G) maturing follicle cells, (H) enteroendocrine cells in the midgut, (I) two 
PNS neurons. 
  
  117 
 
Figure 2-12 Overexpression of Actβ in motoneurons or neuroendocrine 
cells increases adult body size.  
Relative to controls (UAS-Actβ, left) overexpression of Actβ (line 3B2 or 4BA) in 
motoneurons (OK6-Gal4, right) or neuroendocrine cell (C929-Gal4, middle) 
results in larger animals. The body length for the indicated genotype shown 
(bottom panel) with representative images of adult flies (top panel). n = 20-30 
individuals, bars indicate mean ± SEM. 
  
  118 
Figure 2-13 Hyperactivation of Activin signaling in muscles but not fatbody 
is larval lethal 
Images of  pupae resulting from overexpression of constitutively activated Babo 
(BaboQD) or Actβ in the fat-body (Cg-Gal4, left) or  muscles (MHC-Gal4, right). 
Note that the left most pupa in which activated Babo was expressed in the 
fatbody produces a normal pupa that gives rise to a viable adult. However  
expression of the ligand (Actβ) in  the fatbody  produces a larval lethal phenotype 
similar to that produced by either overexpression of Actβ or activated receptor in 
muscle.  We conclude that overexpression of the ligand in the fatbody produces 
a lethal phenotype by non-autonomous activity in the muscles. 
  
  119 
Figure 2-14 OK372-Gal4 is not expressed in Dimm+ neuroendocrine cells 
Third instar larvae brains of OK371-Gal4>UAS-GFP (green) were dissected and 
stained with ⍺-Dimm (red). We find no overlap in signals  demonstrating that 
OK371-Gal4 is not expressed in Dimm+ cells (merge panel, right). 
 
  
  120 
 
Figure 2-15 Muscle specific activation of Activin signaling increases body 
size but not wing size 
(A-B) Overexpression of activated Babo (BaboQD) in muscles results in larger 
pupae (A) and adult larger adult flies (B). (C-D) Overexpression of activated 
dSmad2 (dSmad2SDVD) in muscles also results in larger adult flies. (D) adult wings 
of MHC>dSmad2SDVD are smaller than MHC-Gal4 control.  
  
  121 
 
Chapter III 
 
 
Muscle-derived Myoglianin regulates imaginal 
disc growth  
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Others that contributed to this chapter: 
Aidan J. Peterson conducted experiments for figure 3-4 (C-E).  
All other experiments were done by me. 
  
  122 
SUMMARY 
Organ growth and size is finely tuned by intrinsic and extrinsic signaling 
molecules. In Drosophila, the BMP family member Dpp is produced in limited set 
of imaginal disc cells and functions as a classic morphogen that regulates pattern 
and growth by diffusion through the tissue. The role of Activin-like ligands in disc 
growth control however, remain ill-defined. Here we demonstrate that among the 
three Drosophila Activin-like ligand, only myoglianin (myo) controls wing imaginal 
disc growth and it does so as an extrinsic signal that is produced by body-wall 
muscle. In the wing disc, muscle derived Myo stimulates phosphorylation of the 
downstream signal transducer and transcription factor dSmad2, and requires 
type I receptor isoform Babo-A, type II receptor Punt, and the co-receptor 
immunoglobin like protein Plum. Loss and gain-of-function studies demonstrate 
that Myo signaling, or lack thereof, can alter the final wing size from -40% to 
+20% of its total surface area, by controlling cell proliferation. We propose that 
this mechanism provides a means of coordinating muscle size with appendage 
size which is likely important for overall fitness and survival of the species. 
  
  123 
INTRODUCTION 
How organ growth is regulated to achieve proper scaling with final body 
size has been a long standing question in developmental biology. Organ growth 
is a dynamic process that is finely tuned by highly conserved molecules that are 
produced within the tissue (intrinsic) as well as in other distant organs (extrinsic) 
that act in an endocrine manner (Boulan et al., 2015; Hariharan, 2015; Johnston 
and Gallant, 2002; Mirth and Shingleton, 2012). These growth signals regulate 
final organ size through three distinct processes, cell division (proliferation) mass 
accumulation (cell growth) and cell death (apoptosis). The Drosophila wing 
imaginal disc, the larval precursor to adult wings and thorax, has been widely 
used as a model to study the molecular mechanisms that control organ growth 
and size control (Martin et al., 2009). Genetic analysis has identified numerous 
wing disc intrinsic factors, such as Wnt, Hedgehog, Bone Morphogenetic Protein 
(BMP) homologs, that are required for proper patterning and proliferation 
(Hariharan, 2015). In contrast, examples of extrinsic factors that regulate 
imaginal disc growth are not as common. The Insulin-like signaling pathway is 
one clear exception. Insulin-like peptides are produced in the brain and fatbody 
and are well known to promote both growth and proliferation in many tissues 
including imaginal disc cells (Boulan et al., 2015; Grewal, 2012; Nijhout, 2003; 
Shingleton et al., 2007; Sopko and Perrimon, 2013). Insulin-like factors act in a 
physiological capacity to coordinate overall organismal growth with nutrition. 
Identification of other extrinsic signals that might provide additional means of 
  124 
coordinating growth specifically between tissues could provide new insights into 
mechanisms governing coordinated organ scaling.  
The largest and most diverse group of signaling molecules belong to the 
Transforming Growth Factor β (TGF-β) superfamily of growth and differentiation 
factors. The superfamily is subdivided into the BMP and the TGF-β/Activin-like 
subfamilies based on sequence and signaling relationships. In higher 
vertebrates, these growth factors play a myriad of roles during development from 
cell fate specification and stem cell maintenance to control of cellular growth and 
proliferation (Morikawa et al., 2016). Both branches of TGF-β are conserved in 
Drosophila, where limited functional redundancy and a powerful genetic toolkit 
provide an attractive system for study. The Drosophila BMP ligand 
Decapentaplegic (Dpp) functions as a classic intrinsic morphogen, secreted from 
a single source and diffusing throughout the tissue, to regulate proliferation and 
patterning based on its concentration gradient (Campbell and Tomlinson, 1999; 
Lecuit et al., 1996; Restrepo et al., 2014). Conversely, the Activin-like branch 
also plays a significant role in disc growth, however it is much less well 
characterized (Brummel et al., 1999; Hevia and de Celis, 2013; Peterson and 
O’Connor, 2013).  
In Drosophila Activin-like signaling is initiated by three ligands, which 
include Myoglianin (Myo), Activinβ (Actβ), and Dawdle (Daw). These ligands bind 
to and activate a hetero-tetrameric receptor complex on the cell membrane 
consisting of two type-I receptor subunits encoded by baboon (babo) and two 
  125 
type-II receptor subunits encoded by either the punt or wishful-thinking (wit) 
genes or perhaps a combination of the two. (Upadhyay et al., 2017). Activated 
Babo phosphorylates cytosolic dSmad2 which then accumulates in the nucleus 
and, along with a co-Smad, regulates expression of target genes (Brummel et al., 
1999; Hevia et al., 2017). Notably, there are three splice isoforms of babo with 
different ligand binding domains, which presumably provide ligand binding 
specificity (Jensen et al., 2009). Babo null mutant die at the larval-pupal transition 
and have significantly smaller wing imaginal discs, and escapers produced by 
hypomorphic alleles also have smaller adult wings (Brummel et al., 1999). 
Furthermore, expression of constitutively activated Babo in wing imaginal discs 
leads to larger adult wings without significantly altering cells size, suggesting that 
Activin-like signaling has a role in regulating proliferation (Brummel et al., 1999; 
Hevia and de Celis, 2013). Additionally, Babo can signal non-canonically through 
Mad (the BMP Smad) to stimulate wing disc overgrowth, but only in the 
background of a protein null allele (dSmad2f4) and not with a genetic null 
missense allele (dSmad2MB388) that produces a non-functional product (Peterson 
and O’Connor, 2013).  
For both the canonical dSmad2 and the non-canonical Mad signaling 
pathways, it remains unclear which Babo isoform and which Activin-like ligands, 
or combination thereof, regulates disc growth. It is also not clear which tissue(s) 
provide the ligands that promote disc growth. Expression analysis by in-situ 
hybridization or transcriptome analysis suggests that all Activin-like ligands are 
  126 
expressed in the imaginal wing disc, albeit at low levels, perhaps indicating 
collective contribution to stimulating tissue growth (Gramates et al., 2017; Hevia 
and de Celis, 2013). However it is important to recognize that mRNA expression 
does not necessarily correlate with functional ligand production, especially since 
TGFβ-type ligands undergo a series of post-translational modifications, including 
glycosylation, pro-domain cleavage, and dimerization, to generate an active 
molecule and these processes may vary within different tissues (Ballard et al., 
2010; Upadhyay et al., 2017). 
Here we report our analysis of how Activin-like ligands and Baboon 
isoforms regulate imaginal disc growth. Through a series of genetic experiments, 
we demonstrate that among the three Drosophila Activin-like ligands, only Myo is 
required for proper growth of imaginal discs. We also identify the receptors Babo-
A, and Punt along with the co-factor Plum as being necessary for Myo dependent 
phosphorylation of dSmad2 resulting in proper growth of imaginal discs. 
Surprisingly, we identify the tissue source of Myo that controls disc growth to be 
the larval muscle. We speculate that Myo acts a myokine, to help coordinate 
muscle with appendage growth.  
  
  127 
RESULTS 
Myoglianin is required for proper discs growth 
All Drosophila Activin-like ligands (Myo, Actβ, and Daw) have tissue 
specific function yet signal via the sole Type-I receptor Babo. Hence, the babo 
mutant phenotype is likely a composite of all three individual ligand mutant 
phenotypes. The imaginal discs of babo mutants are approximately 30% smaller 
than wildtype but do not exhibit any obvious defects in tissue patterning 
(Brummel et al., 1999). We set out to identify which Activin-like ligand(s) are 
required for proper imaginal disc growth. The null mutants myo, Actβ, and daw 
are larval lethal (Awasaki et al., 2011; Ghosh and O’Connor, 2014; Zhu et al., 
2008). Therefore, we analyzed the size of imaginal wing discs from late 3rd instar 
larvae of null mutant animals. For this initial analysis, we used a simple 
yeast/sugar diet (5Y5S) food, because daw mutants are sensitive to standard 
acidic cornmeal food (Ghosh and O’Connor, 2014). Interestingly, only myo 
mutants phenocopies babo small disc phenotype (Brummel et al., 1999). Myo 
discs are approximately 40% smaller than yw controls, but retain its normal 
shape and pattern (Fig. 3-1 B,E). Actβ mutant discs had no significant size 
defects, however daw mutant discs were slightly smaller, which could might be 
attributable to the reduction of insulin secretion in the daw mutants (Fig. 3-1 C-E) 
(Ghosh and O’Connor, 2014). Previous studies suggested that all Activin-like 
ligands are expressed in the wing disc (Hevia and de Celis, 2013). Despite this 
  128 
observation, our result clearly suggests that only myo is functionally required for 
growth of the discs, and that other ligands may have other functions apart from 
disc growth. We next asked whether other imaginal tissues such as the haltere 
and leg discs are also affected by the loss of myo. Indeed, all three imaginal 
discs of myo mutants are approximately 50% smaller (Fig. 3-1F-H). Furthermore, 
by analyzing discs from the same animal, we determined that the size ratio of 
discs are not different in myo mutants vs yw controls (Fig. 3-1I). This suggests 
that Myo signaling regulates tissue growth in all three imaginal discs equally. 
  
To explain the myo small discs phenotype, we measured cell size, 
proliferation, cell growth, and apoptosis. First, to assess cell size we measured 
the apical surface area of disc epithelial cells by phalloidin staining, which marks 
the apical actin belt, and found that wing disc cells of myo mutants are 22% 
smaller than controls (Fig. 3-1 J-L). Next, we measured proliferation rates by 
staining for phospho-Histone 3(ser10) which marks mitotic cells in discs, and 
found no significant difference between myo discs and controls (Fig. 3-1, M-O). 
Third, using apoptotic marker cleaved-caspase 3, we found no increase in 
apoptosis in myo mutants (Fig. 3-6 A, B). Another possible reason why myo 
mutant discs do not grow properly is a defective TOR signaling pathway. To 
address this, we stained growing early L3 imaginal discs for phospho-S6, which 
is a target of pS6k and is a readout of TOR pathway activation. We find no 
decrease in pS6 staining in myo mutant discs, indicating that TOR signaling is 
  129 
not perturbed in these cells (Fig. 3-6 C, D). To briefly summarize Myo mutant 
imaginal discs are smaller in part due to smaller cells, but not increased 
apoptosis, defective proliferation or TOR activation. Important to note, that the 
22% decrease in cell size is insufficient to completely account for 40-50% 
decrease in total tissue size. This could be due to the fact that our assays are 
snapshot experiments of fixed tissues. Therefore, we cannot completely rule out 
that there may be some proliferation, apoptosis, or cell growth defects during 
other stages of development. It has been reported that hyperactivation of Babo in 
the wing imaginal disc leads to approximately half of the cells undergoing one 
extra round of cell division (Brummel et al., 1999). Thus, it is possible that loss of 
myo results in smaller cells as well as slower/fewer rounds of cell proliferation 
accruing over the course of entire larval development resulting in overall smaller 
tissue. Such mild defects could gradually accumulate which could explain the 
phenotype. 
Myo is homologous to vertebrate Mstn, which negatively regulates skeletal 
muscle size by inhibiting proliferation of muscle stem cells (Morikawa et al., 
2016) and regulation of protein homeostasis (Lee et al., 2011; Rodriguez et al., 
2014; Trendelenburg et al., 2009). Recent studies in Drosophila using RNAi 
tissue specific knockdown methods suggested that Myo also functions as a 
negative regulator of muscle size similarly to vertebrate Mstn (Augustin et al., 
2017). We re-examined this issue using myo null alleles. Surprisingly, we found 
that the surface area of late L3 body wall muscles #6 and #7 (Segment A2) are 
  130 
13% smaller than heterozygous controls but contain the same number of nuclei 
indicating no defect in myoblast fusion. (Fig. 3-1P-S). We conclude that respect 
to muscle size control, that Drosophila myo is not functionally conserved with 
vertebrate Mstn. 
 
Myo signals canonically via dSmad2 
Canonical TGFβ/Activin pathway activation in Drosophila is mediated by 
C-terminal phosphorylation of dSmad2 by the Type-I receptor Baboon (Brummel 
et al., 1999; Peterson and O’Connor, 2014). To determine if Myo acts through the 
canonical signaling pathway, we examined phosphorylated dSmad2 (p-dSmad2) 
levels in wing disc extracts of various mutants. Total wing disc cell extracts of late 
L3 larvae from yw, myo heterozygotes and null animals were western blotted for 
anti phospho-dSmad2. Indeed, we observe a dose dependent reduction in p-
dSmad2 levels upon loss of myo, i.e. in heterozygous myo+/- the p-dSmad2 
signal is reduced compared to wildtype whereas in homozygous mutants it is 
virtually absent (Fig. 3-1T). These findings strongly suggest that Myo signals 
canonically via dSmad2 in imaginal discs (Fig. 3-1U).  
 
  131 
Myo signaling in imaginal discs requires a specific isoform of Baboon  
Baboon, the sole TGFβ/Activin receptor in Drosophila, has three splice 
isoforms (Awasaki et al., 2011; Jensen et al., 2009). The three splice isoforms 
are a result of mutually exclusive alternative splicing of the fourth exon (4a, 4b, 
4c) giving rise to three receptors (Babo-a, Babo-b, and Babo-c) that differ only in 
their extracellular-ligand binding domains (Brummel et al., 1999; Jensen et al., 
2009). It has been suggested that different tissues express different isoforms, 
perhaps in order to tune tissue-specific responses to various ligands (Awasaki et 
al., 2011; Jensen et al., 2009; Peterson and O’Connor, 2014). Ectopic Myo 
signaling in the larval brain is lethal, however this can be rescued by 
simultaneously knocking down Babo-a but not Babo-b or Babo-c (Awasaki et al., 
2011). This suggests that Myo signals specifically via Babo-a. Since only myo is 
required for proper growth of imaginal discs (Fig. 3-1B), we reasoned that Babo-a 
should be the major Babo isoform expressed in the discs, a conjecture confirmed 
by qPCR analysis of dissected late L3 wing discs (Fig. 3-2A). We confirmed that 
our primers for Babo-b and Babo-c are functional by testing other tissues such as 
carcass, brain, and fat body where we find different profiles for each isoform. 
(Fig. 3-7).  
To confirm that the Babo-a isoform is indeed required for wing growth, we 
employed the GAL4/UAS system for tissue and isoform specific RNAi knockdown 
experiments. Using escargot (entire disc), cubitus (anterior), and hedgehog 
(posterior) GAL4 lines, we knocked down specific Babo isoforms and measured 
  132 
overall tissue size and cell size/density. In support of the qPCR data, we find that 
knocking down Babo-a alone with esg-GAL4 results in 40% smaller adult wings, 
whereas knocking down Babo-b or Babo-c resulted in no size difference (Fig. 3-2 
B-E, J). Ci>GAL4 driving ibabo-a reduces the anterior compartment by 50% (Fig. 
3-2 F-I, L), likely due to Ci>Gal4 being a stronger driver than esg>GAL4. We next 
assessed cell size in these wings by measuring trichome density in adult wings. 
RNAi for Babo-a using esg-GAL4 or ci-GAL4 results in a fractional decrease (-
6%) or increase (12%) in cell density respectively (Fig. 3-2 K, M) indicating that 
the esg driver results in slightly larger cells whereas ci driver results in somewhat 
smaller cells. Assuming the number of wing disc precursors at embryonic stage 
is the same in both conditions, we infer that the esg driver leads to smaller wing 
size (Fig. 3-2 C) due to defects in proliferation, whereas, in the case of the ci 
driver, the smaller compartment size (Fig. 3-2 G) is due to both smaller cells and 
fewer cell divisions. As a further test, we repeated the experiment with hh-GAL4 
which is expressed in the posterior compartment. Knockdown of babo-a using hh 
driver is pupal lethal, thus we analyzed the late L3 imaginal wing discs. At this 
stage, in addition to the predicted smaller posterior compartment (-35%, Fig. 3-2 
P), we observe two additional phenotypes that are obscured in adult wings. 
Knockdown of babo-a results in an imperfect anterior/posterior boundary 
formation (Fig. 3-2 N-O) as well as a 40% decrease in epithelium thickness (Fig. 
3-2 Q). The thin epithelium is a result of fewer disc cell stratified along the z axis, 
which suggests that there are far fewer cells in the compartment than estimated 
  133 
simply based on the 2-dimensional area measurement (Fig. 3-2 P). Taken 
together, these set of experiments demonstrates that Babo-a is the only 
functional isoform in the wing imaginal disc, and loss of babo-a phenocopies myo 
mutants in regulating wing disc growth. Thus, similar to mushroom body neurons 
case (Awasaki et al., 2011), our data demonstrate that Myo signals solely 
through Babo-a in the wing imaginal disc.  
 
Babo-a, Punt, and Plum mediate non-canonical signaling in wing imaginal 
discs 
In addition to canonical signaling, Babo can also signal non-canonically by 
interacting with downstream components of the BMP/Dpp pathway(Peterson and 
O’Connor, 2013). Non-canonical Babo activity is noticeable only in a protein null 
mutant of dSmad2 or strong RNAi knockdown of dSmad2 (Peterson and 
O’Connor, 2013; Peterson et al., 2012; Sander et al., 2010). The current model 
suggests that Babo, in the absence of its preferred target dSmad2, 
promiscuously activates Mad, the BMP ortholog of dSmad2 (Peterson and 
O’Connor, 2013). This ectopic Babo/Mad activation occurs throughout the disc 
including at the lateral edges where it represses brk expression, which normally 
suppresses growth, and therefore results in overgrowth of the tissue along the 
anterior-posterior axis (Peterson and O’Connor, 2013). We hypothesized that the 
non-canonical signaling is mediated through Babo-a and not through other 
  134 
isoforms ectopically signaling in the absence of dSmad2. Babo activation can be 
visualized in dSmad2 loss-of-function clones using the brk (b14-LacZ) reporter 
(Müller et al., 2003; Peterson and O’Connor, 2013). We used this assay and first 
generated dSmad2 RNAi clones and confirmed the ectopic brk-LacZ silencing 
(Fig. 3-3 A). Next, we performed genetic epistasis analysis by simultaneously 
knocking down dSmad2 plus a specific Babo isoform in clones and then assayed 
for brk-LacZ rescue. Knocking down dSmad2 and Babo-a rescued brk reporter 
expression (Fig. 3-3 A vs B), while the RNAi of dSmad2 and Babo-b or Babo-c 
did not (Fig. 3-3 A vs C-D). To further test if non-canonical activity of Babo-a 
occurs throughout the disc we knocked down dSmad2 in the entire disc using 
esg-GAL4, which results in the overgrowth phenotype (Fig. 3-8 A-B) (Peterson 
and O’Connor, 2013; Sander et al., 2010). The overgrowth phenotype can be 
quantified by measuring the wing disc pouch height/width ratio. RNAi for dSmad2 
alone results in the H/W ratio dropping from 0.91 (ctrl, esg>) to 0.66 
(esg>idSmad2) (Fig. 3-8 D-E). Similar epistasis analysis with specific babo 
isoforms demonstrates that only RNAi of babo-a and not babo-b or babo-c, 
suppresses the RNAi-dSmad2 induced widening phenotype (Fig. 3-8). These two 
sets of experiments suggest that Babo-a is the sole signaling receptor in the wing 
imaginal disc mediating both canonical and non-canonical signaling. 
TGFβ signaling requires ligands binding to hetero-tetrameric type-I and 
type-II receptor complexes. There are two type-II receptors in the Drosophila 
genome: punt and wishful thinking (wit), both of which can signal with Type-I 
  135 
receptors from either branch of the TGFβ superfamily (Upadhyay et al., 2017). 
Punt is more commonly utilized during development, and facilitates Dpp signaling 
in the wing imaginal disc in combination with the BMP type I receptors Tkv and 
Sax (Brummel et al., 1994; Fuentes-Medel et al., 2012; Letsou et al., 1995; 
Parker et al., 2006). In cell culture models however, Punt can signal in 
combination with Babo and Activin-like ligands (Brummel et al., 1999; Jensen et 
al., 2009; Letsou et al., 1995). Wit on the other hand functions primarily in 
neuromuscular junction, with the BMP ligand Gbb (Marqués et al., 2002) 
although it has been shown to bind the Activin-like ligand Myo in combination 
with Babo (Lee-Hoeflich et al., 2005). Both punt and wit are expressed in the 
wing imaginal disc, however it is unclear whether one or both type II receptors 
are require for Myo-Babo signaling (Gramates et al., 2017). To address this issue 
we utilized the non-canonical brk silencing assay in RNAi clones. We find that 
ectopic silencing of brk by loss of Smad2 is completely suppressed by the 
simultaneous RNAi of punt (Fig. 3-3 E vs G). However, RNAi for wit does not 
suppress the brk silencing in the same context (Fig. 3-3 E vs F). Taken together, 
these experiments demonstrate that Babo-a requires Punt, but not Wit, for proper 
control of brk expression in this non canonical wing disc signaling assay. Thus, 
we conclude that Myo and Babo-a also signal with Punt to control normal wild-
type wing disc.  
In addition to Type-I and Type-II receptors, various sorts of additional co-
receptors have been found to interact with TGFβ ligands and receptors to 
  136 
facilitate signaling (Heldin and Moustakas, 2016). Drosophila plum encodes an 
immunoglobulin superfamily protein, and is required for Myo stimulated pruning 
of mushroom body neurons (Yu et al., 2013). Therefore, we examined whether 
plum also facilitates Babo activity in the context of wing imaginal disc growth. 
Indeed, we find that plum-RNAi in the wing disc completely suppresses the 
dSmad2 mutant overgrowth phenotype, confirming that Plum is required for 
Myo/Babo signaling in the wing disc as well (Fig. 3-9). This observation together 
with the previous report (Yu et al., 2013) suggest that Plum may be a general 
requirement for Myo/Babo signaling in Drosophila.  
 
Muscle derived myoglianin signals to the wing disc 
Growth factors such as Wg and Dpp, are tissue intrinsic ligands which are 
produced by and act on the wing disc cells. We sought to determine the source 
of Myo that signals to the imaginal discs. The name myoglianin refers to the two 
tissues (muscles and glia) in which myo expression was initially discovered (Lo 
and Frasch, 1999). More recent RNA in situ hybridization experiments suggested 
that myo might also be expressed in the wing imaginal disc at low levels (Hevia 
and de Celis, 2013). To determine the source of Myo acting on the wing disc, we 
first, examined the expression pattern of myo in late L3 larvae using myo-GAL4 
reporter to drive UAS-CD8-GFP (Awasaki et al., 2011). We detect GFP 
expression in both the glial cells of the brain and ventral ganglia as well as the 
  137 
larval body wall muscles (Fig. 3-4 A-B). Importantly, we do not observe any GFP 
signal in the wing imaginal disc (Fig. 3-4 A). Thus, we conclude that either myo is 
not expressed in the wing disc or that our myo-Gal4 construct does not have all 
of the endogenous enhancers.  
To determine the functional source of Myo that controls imaginal disc 
growth, we conducted loss-of-function studies in the dSmad2 null mutant 
background, and tested for rescue of the disc overgrowth phenotype. First, using 
null mutant alleles, we confirmed that the dSmad2;;;myo double mutant discs 
suppress the dSmad2 overgrowth and are small like myo mutants and have wild 
type height/width proportions (Fig. 3-4 C-E). Next, we knocked down myo using 
tissue specific GAL4 drivers. To confirm efficacy of the RNAi constructs, we used 
the da>Gal4 driver to ubiquitously knock down myo in the dSmad2 background 
and confirmed that it leads to a complete suppression of the wing disc 
overgrowth (Fig. 3-4 F vs G). Second, knocking down myo using either esg-
GAL4 (wing disc) or repo-GAL4 (glia) failed to suppress the dSmad2 wide wing 
disc phenotype (Fig. 3-4 F vs H-I). This suggests that in these animals Myo is still 
able to signal to the discs and cause the overgrowth. In contrast, RNAi for myo in 
body wall muscles, using either MHC-GAL4 or mef2-GAL4 drivers, completely 
suppresses the dSmad2 disc overgrowth phenotype phenocoping the 
dSmad2;;;myo double mutant (Fig. 3-4 F vs J-K). It is notable that when myo is 
knocked down in the muscles, expression in other tissues such as the glia and 
potentially the wing disc are unperturbed, but such signaling especially in the disc 
  138 
itself is not sufficient to stimulate disc overgrowth in dSmad2 mutants. Therefore, 
we conclude that muscle is likely the major source of Myo that stimulates 
imaginal disc growth. 
 
Overexpression of Myo in muscle or fat body rescues myo mutant disc 
growth 
 While the suppression of disc overgrowth in a dSmad2 mutant 
background strongly implicates muscle as the source of ligand, we also wished to 
examine if Myo expression in muscle, or other non-disc tissues, could rescue 
disc size in myo mutants. Surprisingly, overexpression in glia (repo>Gal4) 
provide some rescue (Fig. 3-5 C, F) while overexpression in muscle (Mef2>Gal4, 
Fig. 3-5 D,F) and fat body (CG>Gal4, Fig. 3-5 E, F) provided complete rescue 
and overexpression with a second muscle driver (MHC>Gal4) actually produced 
a large wing (Fig. 3-10). This resupply assay raises a couple of issues. The first 
is that Myo can act non-disc autonomously, most likely through the hemolymph, 
to drive disc growth. The second is that the growth response likely depends on 
the level and or activity of Myo being produced in the distal tissue. Thus, while 
loss of endogenous glial derived Myo is not sufficient to suppress disc 
overgrowth in the dSmad2 knockdown epistasis assay, overexpression of Myo 
using repo>Gal4 is expected to provide more Myo than the endogenous glial 
source and can therefore partially rescue the myo wing disc growth defect. 
  139 
Likewise, expression from a large tissue such as muscle or fatbody produces 
more Myo than glia leading to normal disc growth or even overgrowth at high 
levels. It is also possible that Myo signaling activity is modified depending on the 
tissue source. As with most TGFβ family members, Myo probably needs to be 
cleaved by a furin protease at its maturation site to separate the C-terminal 
ligand from the prodomain (Akiyama et al., 2012; Fritsch et al., 2012; Künnapuu 
et al., 2009). However, Myo may require a second cleavage by a Tolloid protease 
family member to actually achieve full dissociation of the prodomain from the 
ligand (Serpe and O’Connor, 2006) and either of these cleavage reactions might 
be different depending on the tissue source. Considering all the data, the results 
of this study suggest that muscle-derived Myo reaches the discs in an endocrine-
like manner through the hemolymph to activate a specific receptor complex 
containing Babo-A, Punt and Plum that signals to dSmad2 and associated 
factors to promote imaginal disc growth. 
 
DISCUSSION  
Understanding the roles of inter-organ signaling during development is an 
emerging and complex aspect of biology. In particular, how inter-organ signaling 
regulates organ/tissue growth remains an open question. In the present study, 
we demonstrate that the Drosophila Activin-like ligand Myoglianin, is a muscle 
derived myokine that acts systemically to fine tune imaginal disc growth. We 
  140 
suggest that tuning of disc growth by Myo may play an important role in 
maintaining proper allometric scaling of appendage size with the size of the 
muscles that control their movements.  
 
Only Myo regulates imaginal disc size 
 Although Babo/dSmad2 signaling has been implicated in imaginal disc 
growth control for some time (Brummel et al., 1999; Hevia and de Celis, 2013; 
Peterson and O’Connor, 2013) the ligand(s) responsible and their production 
sites(s) have not been identified. Previous in situ hybridization and RNAi 
knockdown experiments suggested that all three Activin-like ligands (Myoglianin, 
Activinβ, and Dawdle) affect wing size (Hevia and de Celis, 2013). However, our 
ligand reporter constructs show no expression in imaginal discs, with the one 
exception being Actβ which is expressed in differentiating photoreceptors of the 
eye imaginal disc (Moss-Taylor et al., 2019; Zhu et al., 2008). More importantly, 
using genetic nulls we show that only loss of myo affects imaginal disc size. A 
discrepancy between RNAi tissue-specific knockdown results and the genetic 
nulls with respect to phenotypes is often noted and not fully understood. Besides 
simple off-target effects within the wing disc itself, one possible explanation is 
that many GAL4 drivers are expressed in other tissues besides the target tissue 
of interest, potentially resulting in deleterious effects for the animal that indirectly 
affect size of the tissue. Another possible explanation is that perhaps in Actβ and 
  141 
daw genetic null backgrounds a non-autonomous compensatory growth 
promoting signal is generated by some other tissue that does not occur in the 
case of tissue-specific knockdown. We think both these explanations are unlikely 
in this instance since we demonstrate that only the Babo-a receptor isoform is 
expressed in discs, and we have previously shown that Daw only signals through 
the Babo-c isoform (Jensen et al., 2009). Therefore, it is challenging to explain 
why knockdown of daw in the wing disc would result in a small wing phenotype 
(Hevia and de Celis, 2013). Similarly Actβ appears to primarily use the Babo-b 
isoform, which is not expressed in discs, for signaling (Moss-Taylor et al., 2019). 
We conclude that the small wing phenotypes caused by RNAi knockdown of Actβ 
and daw are probably the result of some unknown off-target effect and that Myo 
is the only Activin-type ligand that regulates imaginal disc growth.  
 
Plum and Punt are required for efficient Babo-A signaling to dSmad2 in the 
wing disc  
The signaling ability of TGFβ ligands is modulated by the specific 
combinations of receptors and co-receptors to which they bind (Heldin and 
Moustakas, 2016; Upadhyay et al., 2017). In Drosophila, the receptor 
requirements for effective signaling through dSmad2 are likely to be different for 
each ligand and tissue (Jensen et al., 2009). In this report, we find that Myo 
signaling in the wing disc requires Punt as the type II receptor, Babo-a as the 
  142 
type I receptor and Plum as a co-receptor. Furthermore, we establish that Myo is 
predominant Activin-like ligand signaling to the discs since p-dSmad2 levels are 
practically absent in myo mutant discs. Since Babo-a is the only isoform 
expressed in wing discs we also conclude that Myo can function solely through 
this isoform in the absence of other isoforms. Whether Myo can also signal 
through Babo-b or c is not yet clear, although it should be noted that in the 
context of remodeling MB neurons Babo-a also appears to be the major receptor 
isoform required for efficient Myo signaling (Awasaki et al., 2011). Furthermore, 
similar to MB neurons where Plum is required for efficient Myo/Babo-a signaling, 
Plum is also required in the wing discs for growth (Yu et al., 2013). At present it is 
not clear whether Punt is the only type II receptor that can produce an efficient 
signaling complex with Myo. In the mushroom body case, indirect genetic 
evidence suggests that the two Type II receptors function redundantly (Zheng et 
al., 2003). However, in our wing disc example, only loss of Punt produces a 
phenotype in the brk reporter assay even though Wit is expressed in the wing 
disc (Marqués et al., 2002). The requirement of Punt and Plum for Myo signaling 
may also explain why a previous attempt to study Myo signaling in a heterotypic 
cell culture model failed (Lee-Hoeflich et al., 2005). In that study, Myo was found 
to form a complex with Wit and Babo-A in COS-1 cells but no phosphorylation of 
dSmad2 was reported. One explanation is that effective signaling by Myo 
requires Punt and Plum, as well as Babo-A, and neither of these is found in 
mammalian cells. Therefore, to our knowledge, the data reported here provides 
  143 
the first in vivo functional evidence that identifies a complete signaling network 
for Myo. 
  
Intrinsic (intra-organ) vs extrinsic (inter-organ) mode of Myo signaling 
The most intriguing finding of this study is that muscle derived Myo acts 
non-autonomously to regulate disc growth. This is in stark contrast to the two 
BMP ligands Dpp and Gbb which are produced by disc cells and act 
autonomously with in the disc itself to regulate both growth and pattern (Haerry et 
al., 1998). The fact that a TGFβ ligand can act in an endocrine like manner is not 
particularly novel since many vertebrate members of the TGF beta family, 
including Myostatin, the closest homolog to Drosophila Myoglianin, are found in 
the blood (Rodgers and Eldridge, 2015). Even the disc intrinsic molecule Dpp 
has been recently shown to be secreted into the hemolymph where it circulates 
and signal to the prothoracic gland to regulate a larval nutritional checkpoint 
(Setiawan et al., 2018). Several reports indicate that ligands from the Activin-like 
subfamily circulate in the hemolymph to function in inter-organ signaling. For 
example, muscle derived Activinβ and Myoglianin signal to the fat-body to 
regulate mitochondrial function and ribosomal biogenesis respectively (Demontis 
et al., 2014; Song et al., 2017b). Subsequently, Dawdle derived from many tissue 
signals to the Insulin producing cells and the mid-gut to stimulate Insulin 
secretion and repress expression of sugar metabolizing genes respectively 
  144 
(Chng et al., 2014; Ghosh and O’Connor, 2014). Whether circulating Myo can 
signal to other organs exposed to the hemolymph likely depends on the 
expression of specific type I and co-receptors in the target tissue. Nevertheless, it 
is likely the rule rather than the exception that most TGFβ ligands can act either 
locally or systemically. 
Our study also points to another important question, how Myo is able to 
reach the disc cells? Whether it can signal from the basement membrane or the 
apical surface of the discs cells is unknown. TGFβ receptors are often restricted 
to the basolateral surface (Saitoh et al., 2013). Thus it is possible that Myo may 
be signaling through the basement membrane of the discs, however this must be 
experimentally tested. Furthermore, does Myo transport in and out of the disc 
using similar mechanisms as Dilps or Dpp? Certain Dilp ligands need to get 
inside the disc cells to regulate cell growth, whereas other, like Dilp 8 leave the 
tissue to regulate developmental timing (Colombani et al., 2012). Dpp can also 
exit the disc to regulate timing (Setiawan et al., 2018), and here our data 
suggests that systemic Myo must be getting inside. Whether these ligands 
navigate the same or different paths is an open question. 
 
Significance of inter-organ communication 
Endocrine signaling enable communication between two organs that need 
to function together (Droujinine and Perrimon, 2016). For example, Daw 
  145 
mediates environmental and nutritional inputs into the fat-body (energy storage 
organ) and relays that information to other organs that regulates mechanisms for 
energy uptake and processing (Chng et al., 2014; Ghosh and O’Connor, 2014). 
Perhaps this allows the animal to synchronize different organs between 
feeding/growth phase and starvation/survival phase. The question our data 
raises is why have muscle signal to disc, and that to regulate organ size? One 
plausible explanation is that Myo signaling coordinates the size of appendages 
(the fly wing) to the size of the muscles (the indirect flight muscles). A large 
muscle powering a small wing would probably result in diminished fine motor 
control. Conversely, a small muscle would not be able to power a large wing to 
support flight (Mirth and Shingleton, 2012). These two organs, the muscle and 
wing, may need to be proportional to each other to achieve proper function 
(flight) and maximize fitness (Frankino et al., 2009). Why would coordination 
between the wing and the larval body-wall muscles take place given that the 
larval muscle undergoes histolysis during pupal development, and is replaced by 
a new set of myoblasts? Interestingly, whereas muscles from the abdominal 
segments do undergo complete histolysis, the ones in the thoracic segment do 
not (Dutta et al., 2004). The larval muscles in the thoracic segment are preserved 
as fibers that then act as scaffolds for the larval myoblasts to infiltrate and seed 
to become the adult indirect flight muscles (Dutta et al., 2004). As mentioned 
previously, myo mutants are late larval lethal however, if they were to survive to 
adulthood, they would likely have disproportionately larger flight muscles 
  146 
powering tiny wings. Furthermore the final body size of flies are fixed at the end 
of larval stages, and so it is critical to coordinate the size of individual organs 
prior to metamorphosis. Thus, we propose that muscle-derived Myo may acts as 
a second messenger to synchronize the size of the imaginal discs to overall body 
size to ensure that the adult has large enough wings to fly.  
 
MATERIALS AND METHODS 
Fly strain: 
TGFβ mutants: myo1, myo4, Act80, daw11, dSmad2F4 are described 
previously (Awasaki et al., 2011; Peterson and O’Connor, 2013; Serpe and 
O’Connor, 2006; Zhu et al., 2008). Babo isoform RNAi lines and myo-GAL4 are 
described previously (Awasaki et al., 2011). RNAi lines for dSmad2 and tkv and 
the strategy used to generate new RNAi lines are described previously (Peterson 
and O’Connor, 2013; Peterson et al., 2012). New RNAi lines for wit targeted 
(1103-1608 of NM_079953.3), and punt targeted (1069-1582 of NM_169591.1). 
RNAi lines for myo targeted (bp:2259-3503 of NM_166788.2) utilizing the 
“snapback” gDNA/cDNA hybrid method (Kalidas and Smith, 2002). Stocks and 
methods used for induction of GAL4 flp-out clones are described previously 
(Peterson and O’Connor, 2013)Briefly, clones were induced by incubation at 
37°C for 30 minutes. Larvae were dissected 48 hours later at wandering L3 
stage.  
  147 
ci-GAL4 and hh-GAL4 were kind gifts from H. Steller (Rockefeller 
University). A version of MHC we labeled MHCf-GAL4 was a kind gift from N. 
Perrimon (HHMI, Harvard). UAS-plum-RNAi was a gift from O. Schuldiner 
(Weizmann institute of sciences, Israel) 
The following stocks are available from Bloomington Drosophila Stock 
Center: da-GAL4 (#5460), esg-GAL4 (#26816), repo-GAL4 (#7415), mef2-GAL4 
(#27390), MHC-GAL4 (#55133), cg-GAL4 (#7011), UAS-mCD8::GFP, UAS-
GFP.nls,  
Microscopy and Antibodies: 
Cleaved Caspase-3 (Cell Signaling #9661), phospho-Histone3 (S10) 
(Sigma, H0412). For B14-LacZ reporter detection, wing discs were stained with 
anti-βgalactosidase (Promega, #Z378A). AlexaFluor 568 or 647 (Invitrogen) 
conjugated secondary antibodies were used when required. Larval muscle and 
wing disc epithelium actin-belt were stained with rhodamine-phalloidin. To 
measure wing disc size, tissues were stained with DAPI.  
Tissues for fluorescence microscopy were mounted with 80% Glycerol in 
PBS (0.1% TritonX-100). Wide field images taken with a 20X objective on a Zeiss 
Axiovert microscope. CARV Confocal images were captured using a 20X 
objective on a Zeiss Axiovert. We also used the Zeiss LSM710 for confocal and 
“tile-scanning” imaging.  
  148 
For adult wings, animals were dissected in 95% ethanol, and mounted 
with (50:50) Canadian balsam:wintergreen oil solution. Images were taken with a 
4X objective (for whole wing) and 40X objective (for trichome density).  
Images were processed in FIJI (imageJ). Wing disc size were calculated with the 
DAPI staining then using the threshold and measure functions. For larval muscle 
size and adult wing size, outlines were drawn using the polygon tool. 
Western Blot: 
Mid-late third instar larvae were dissected in cold PBS, and wing imaginal 
discs were collected and washed on ice. Total protein was extracted with RIPA 
buffer (Cell Signaling) with cOmplete protease inhibitor (Roche) and PhosSTOP 
phosphatase inhibitor (Roche). Lysates were mixed with reducing sample buffer, 
boiled, and 10 ∝l of sample were run on 4-12% graded precast gels (Invitrogen). 
Resolved protein samples were transferred to PVDF membrane. Membrane 
blocking and probing were performed using standard protocols for ECL. 
Antibodies used for western blot: phospho-Smad2 (Cell Signaling #3108), 
Tubulin (Sigma #T9026), goat anti-mouse HRP, and goat anti-rabbit HRP. 
qPCR: 
Late-third instar larvae were dissected in cold PBS, and tissues were 
pooled and washed in PBS on ice. Tissues were homogenized in Trizol 
(Invitrogen) and Total RNA purified using RNeasy Mini Kit (Qiagen). cDNA 
libraries were made using SuperScript-III (Invitrogen). qPCR was performed 
  149 
using SYBR green reagent (Roche) on a LightCycler 480. Rpl23 was used as a 
housekeeping gene for normalization. Following qPCR primers were used for 
babo isoforms:  
babo-a: F 5’ GGCTTTTGTTTCACGTCCGTGGA 3’ 
babo-a: R 5’ CTGTTTCAAATATCCTCTTCATAATCTCAT 3’ 
babo-b: F 5’ GCAAGGACAGGGACTTCTG 3’ 
babo-b: R 5’ GGCACATAATCTTGGACGGAG 3’ 
babo-c: F 5’ GACCAGTTGCCACCTGAAGA 3’ 
babo-c: R 5’ TGGCACATAATCTGGTAGGACA 3’ 
  
  150 
CHAPTER III FIGURES 
  
  151 
Figure 3-1. Myoglianin regulates size of imaginal discs by and activates 
dSmad2.  
(A) DAPI staining of wing imaginal discs from late third instar larvae of w1118, 
myo1/4, act80, daw1/11. myo mutants are approximately 50% smaller vs controls 
w1118, scale bar= 100µm, n= 20-40. B-D) Wing, Leg, and Halteer imaginal discs 
of myo1/4 mutants are 50% smaller vs heterozygous controls myo+/-. C) size of 
different imaginal disc, normalized to controls. D) Size ratio of haltere/wing disc 
(.25) or leg/wing disc (.3) is the same in myo mutants vs controls. E-F) Phalloidin 
staining showing the apical actin-belt of epithelial cells in wing discs, single 
confocal section is shown with the whole disc in insert. Myo1/1 mutant discs cells 
are smaller vs control, circumference of 4 cells is plotted (F), scale bar= 10∝m, 
n>25. G-H) Phospho-Histone H3 (pSer10) (pH3) staining to mark mitotic cells in 
early third instar wing discs. No difference in number of mitotic cells in myo1/1 
mutants. Number of mitotic cells in 100µm2 is plotted (H), scale bar= 100µm, n= 
5. I-K) Phalloidin staining showing the late 3rd instar larvae skeletal muscle 6 and 
7, muscle area (J) and number of nuclei (K) is plotted, scale bar= 100µm, n= 10. 
Myo1/4 mutants have 13% smaller muscles however the number of nuclei does 
not change. L) Western blot analysis of phospho-dSmad2. Myo1/1 mutants lack p-
dSmad2 signal indicating loss of canonical signaling. M) Model for canonical 
TGFβ signaling in wing imaginal disc via Myo->Babo->dSmad2. Myo stimulation 
results in C-terminal activation of dSmad2 (yellow star) which regulates target 
gene expression. 
  
  152 
 
 
  
  153 
Figure 3-2. Baboon-a regulates wing disc growth.  
A) qPCR analysis of Babo isoform expression from late 3rd instar wing imaginal 
discs identifies only babo-a expression. Rpl32 expression used as housekeeping 
gene control. B) RNAi for Babo-a throughout the wing imaginal disc (esg-GAL4) 
or just the anterior compartment (ci-GAL4) results in smaller adult wings and 
anterior compartment respectively (B, 2nd column), scale bar = 1mm. C) 
Quantification of wing size trichome density using esg-GAL4 driver, babo-a RNAi 
wings are 40% smaller however the cells are larger. D) Quantification of anterior 
compartment area and trichome density using ci-GAL4, babo-a RNAi strictly in 
the anterior domain shrinks the size by 50% accompanied by smaller cells 
densely packed. E) RNAi for Babo-a using Hh-GAL4 is pupal lethal. 
Representative image of late larval imaginal discs of control vs Babo-A RNAi, 
UAS-GFP used for indicating expression domain of Hh-GAL4, scale bar = 50µm. 
F) Quantification of posterior domain of larval imaginal discs from Hh-GAL4 
driven RNAi for Babo isoforms. Loss of Babo-a results in 35% smaller posterior 
domain as well as 29% decrease in epithelium thickness. 
 
  
  154 
 
  155 
Figure 3-3. Babo-A and Punt are required for non-canonical silencing of 
brk.  
In the background of Brk-LacZ reporter line random GFP+ (green) clones were 
induced by heat shock 48 hrs prior to analysis (see methods for details). GFP+ 
marked clones also express RNAi for the indicated genes to the left of respective 
panel. Clones at the lateral edges of the disc were analyzed to observe 
patterning defects of the brk reporter. (A-D) Analysis of Babo isoforms. (E-I) 
Analysis of Type-II receptor. (A-I) Max intensity projections of wing imaginal discs 
stained with DAPI (blue) and anti β-gal (red), and fluorescent clone marker 
(green). (A’-I’) Single confocal section of higher magnification of insert in (A-I) 
showing GFP+ marked clone expressing RNAi for indicated genes. Clones are 
outlined with white line. (A’’-I’’) Same confocal section as in (A’-I’) with outlined 
clones showing brk-LacZ reporter expression pattern. Brk reporter is ectopically 
silenced in dSmad2 RNAi clones (A and E). This ectopic silencing is rescued by 
the concomitant RNAi of Babo-a alone (A’’ vs B’’) but not Babo-b or Babo-c (A’’ 
vs C’’ or D’’). Similarly the dSmad2 RNAi dependent brk reporter silencing (E’’) 
can be rescued by the concomitant RNAi of Type-II receptor Punt (E’’ vs G’’) but 
not Wit (E’’ vs F’’). For a control RNAi for punt, plus wit appears different than in 
the brk reporter patterning compared to RNAi for wit alone (F’’ vs H’’). As a 
further control we ensured that the dSmad2 RNAi dependent silencing of the brk 
reporter is not mediated by Dpp-Tkv activation. RNAi for Thickveins (BMP Type-I 
receptor) does not rescue ectopic brk silencing (E’’ vs I’’), indicating that in these 
lateral clones where loss of dSmad2 leads to silencing of brk, it is due to 
signaling by TGFβ/Activin branch. 
 
  
  156 
 
  
  157 
Figure 3-4. Muscle derived Myo is required for non-canonical Babo 
activation in imaginal discs.  
(A) 3rd instar larval fillet showing myo-GAL4 driving CD8-GFP (green), DAPI 
(blue) counterstain to image all tissues in the field of view. DAPI channel (A’) 
shows muscle and cuticle associated cell nuclei, as well as the brain and several 
imaginal discs. GFP channel (A’’) represents the expression pattern of the myo-
GAL4 reporter transgene. Note that the wing imaginal discs does not express 
GFP. (B) Higher magnification of 3rd instar larval brain from myo>NLS-GFP 
showing expression in glial cells. (C-E) myo is epistatic to dSmad2, and rescues 
the disc overgrowth phenotype. dSmad2f4 mutant discs (C) are overgrown, 
however myo mutant discs (D) retain the normal shape of the tissue. The 
dSmad2f4;;;myo double mutant discs (E) are similar to myo mutant discs, 
demonstrating rescue of the overgrowth phenotype, and that Myo can function in 
non-canonical Babo activation. (F-K) Muscle specific RNAi of myo is sufficient to 
rescue wing disc overgrowth phenotype of dSmad2 mutants. RNAi of myo 
ubiquitously using Da-GAL4 rescues the wing disc overgrowth (F vs G), 
phenocopying double dSmad2;;;myo double mutants (E vs G). RNAi of myo in 
either wing discs (esg-GAL4) or glia (repo-GAL4) is unable to rescue disc 
overgrowth (F vs H or I). RNAi of myo in larval muscles using Mef2-GAL4 or 
MHC-GAL4 rescues the disc overgrowth phenotype (F vs J or K), which 
phenocopies ubiquitous myo RNAi (G vs J or K). 
 
  
  158 
 
Figure 3-5. Overexpression of myo in muscles and fat-body rescues wing 
disc size of myo mutants. 
(A-B) myo1/4 mutant discs (B) are smaller than myo+/1 heterozygous controls (A). 
(C-E) wing discs from myo overexpression rescue experiments. Myo 
overexpression in glial cells using Repo-GAL4 partially rescues wing disc size (B 
vs C). This is due to ectopic expression of GAL4 transgenes in salivary glands. 
Overexpression in muscles completely rescues myo mutant discs back to wild 
type size (B vs D vs A). Myo is not normally expressed in the fat-body (Fig 4). 
However, ectopic overexpression in the fat-body is sufficient to rescue discs back 
to wild-type size (B vs E vs A). (F) Quantification of wing discs size from A-E.  
  159 
 
 
Figure 3-6. myo mutants show no defects in cell death or cell growth. 
A-B) Late 3rd instar larval wing discs stained for cleaved-caspase 3 shows no 
increase in cell death of myo1/1 mutant discs. C-D) Early 3rd instar larval wing 
discs stained for phospho-S6, downstream of TOR signaling, shows no defects in 
cell growth. Scale bar= 100µm, n= 5-10. 
  
  160 
 
Figure 3-7 qPCR analysis of babo isoform expression in larval tissues 
Tissues from late 3rd instar larvae express different isoforms of babo. Fat-body 
and Gut express only Babo-c, Brains samples predominantly express Babo-a. 
The carcass sample contains both Muscle and Cuticle associated cells. This 
sample is a mixture of various cell types and thus expresses all three isoforms. 
Expression levels are relative to Rpl23. 
  
  161  
  162 
Figure 3-8. RNAi for Babo-a rescues wing disc overgrowth due to dSmad2 
RNAi. 
(A) Representative image of wild-type (control) imaginal disc. The height/width 
ratio is generally 0.9 (black line in D) for controls. (B) RNAi for dSmad2 
throughout the disc using esg-GAL4 leads to ectopic brk silencing (Peterson and 
O’Connor, 2013) which results in overgrowth of the tissue along the 
anterior/posterior axis (widening) (red squares in D). (C) RNAi for dSmad2 and 
babo (all isoforms) simultaneously rescues the widening phenotype where the 
H/W ratio is back to 0.9 (purple triangles in D). (D) Quantification of pouch size 
from Babo isoform specific rescue experiments. Control samples (Blue 
diamonds) have an average ratio of 0.9; RNAi for dSmad2 (red squares) leads to 
widening with a ratio of 0.6; RNAi for babo (all isoforms, purple triangles) or 
babo-a (green circles) alone rescues the widening back to wild type ratios. These 
discs are smaller than wild type due to loss of canonical baboon activity (Fig.1 
and Fig.2). There is no effect to widening by knocking down either babo-b or 
babo-c (blue and yellow circles vs red squares). 
  
  163 
 
Figure 3-9. Plum is required for non-canonical babo activity.  
dSmad2f4 null mutant wing discs are overgrown and show a widening phenotype. 
(B) esg-GAL4 driving RNAi for plum at 25C in dSmad2 mutant discs rescues the 
overgrowth phenotype. (A) Rearing the same animals at 18C reduces the 
expression of the RNAi transgene thus restoring plum expression which results in 
overgrowth of the imaginal discs. 
  
  164 
 
Figure 3-10. Muscle Overexpression of myo increases wing size 
(A) Muscle specific myo overexpression in addition to endogenous levels 
increases final wing size of adults. (B) Representative wings from A of controls 
(smaller wing) vs MHC>myo (larger wing). Wings are superimposed on top of 
each other to show difference in size. 
  
  165 
 
 
 
 
 
 
 
Chapter IV 
 
Concluding remarks & future directions 
  166 
Brief summary 
How organs scale with overall body size remains an unsolved puzzle. 
Here, I tested the hypothesis that growth factors enable inter-organ signaling 
which regulate growth of the body and organs. Using D. melanogaster as a 
model, I investigated two uncharacterized growth factors which belong to the 
TGFβ superfamily. In chapter two, I show that motoneuron derived Activinβ 
signals to the larval body wall muscles to promote muscle growth and overall 
body size. In the absence of Activinβ, even though both the muscles and the 
animal are smaller, the wing imaginal discs maintain their proper wild type size, 
thus breaking the allometric scaling of wings. In chapter three, I show that muscle 
derived Myoglianin signals to the larval wing imaginal discs to promote disc 
growth. In the absence of Myoglianin, even though the larval muscle size is more 
or less similar to wild type, the imaginal discs are severely smaller (~40%), thus 
breaking the allometric scaling of wings, yet another way. In both muscle and 
imaginal discs, signal transduction via dSmad2 is necessary for proper growth of 
the tissue. These results suggests that either TGFβ signaling via dSmad2 is 
crucial for maintaining allometric scaling relationships or that it is an artifact of 
overall growth.  
Significance of brain - muscle and muscle - wing communication 
Evolutionary theory suggest that there is an advantage of scaling organs 
to body size (Brakefield, 2006). As far as insect wings are concerned, the 
  167 
prevailing notion is that scaling of wings ensures proper flight for the animal 
(Dickinson et al., 1999; Frankino et al., 2009). Wild populations from higher 
latitudes on average have larger wing/body ratio compared to populations in 
warmer clines (Gilchrist and Huey, 2004). Rearing lab stocks in colder 
temperatures also result in larger wing/body ratio (Gilchrist et al., 2000). 
Interestingly, the genetic basis (wild populations) for allometry is due to changes 
in cell number, the plastic basis (temperature effects on lab stocks) for allometry 
is due to changes in cell size (Brakefield, 2006; Frankino et al., 2009). 
Furthermore, the fact that allometric relationships are highly variable across 
species yet invariable within, suggests that selection acts gradually on factors 
that tightly regulate growth of organs.  
The fact that allometry within species is highly invariable suggest that 
there are robust mechanisms regulating organ growth. The mechanism by which 
Myoglianin regulates growth (i.e. the source of the growth factor) may provide the 
robustness necessary for proper allometry within species. As with any gene, it is 
possible that various environmental inputs such as temperature or nutrition may 
affect gene expression. Hence, it is possible that environmental cues regulate 
myo expression which then affects wing size. However, such mechanism alone 
could affect wing size even if myo was expressed in the wing tissue or broadly. 
On the other hand, the larval muscles serve as good estimate for overall body 
size. Therefore, I propose that myo expression in larval body wall muscle 
provides the robustness for disc growth to match overall body size (Fig. 4-1 A). 
  168 
This model predicts that muscle/body size will determine the size of wings, 
which is consistent with observations of wild populations (McCabe and Partridge, 
1997). Hence, our results of Activinβ mutants are quite surprising. The body size 
(and muscle size) of Actβ mutants are dramatically smaller, yet they have wild-
type sized imaginal discs. There is no evidence of Actβ signaling in the imaginal 
discs, which partly explains why Actβ mutants have normal sized disc. However, 
why doesn’t the smaller muscles in these mutants result in smaller imaginal 
discs? This remains an open question, but there are several possible 
explanations. First, the simplest explanation is that Actβ somehow interacts with 
Myo signaling, either by negatively regulating its transcription in the muscle or 
post translationally by negatively regulating its activity (Fig. 4-1 B). Another 
possibility is that loss of Actβ positively regulates other growth factors. These 
possibilities must be experimentally tested to completely understand the Actβ 
phenotype. 
The primary role of Actβ to regulate muscle size should not be overlooked. 
It is intriguing that the nervous system regulates muscle/body size however, it is 
not the first time that such relationships have been documented. For example, 
nerves of a regenerating salamander limb secretes many growth factors, 
including BMPs, that are required for growth (Farkas and Monaghan, 2017). The 
question in Drosophila is, what is the significance of having motoneurons control 
size of the animal? With regard to why this might be important for organ scaling, I 
have no clear answer. However, I must note that regulating body size alone has 
  169 
fitness advantages in insects, that is not due to muscle size or flight (Ewing, 
1964). Essentially, what we observe as scaling defects might not be the primary 
function of Actβ. The primary role of Actβ is most likely regulating motoneuron 
function and coordination with muscle size. 
In summary, a complex inter-organ signaling network regulates organ size 
and more importantly organ scaling. This network not only regulates animal 
growth by facilitating energy metabolism and homeostasis, but also directly 
coordinates growth of organs to pair with overall body size.  
Future directions 
Although the wing imaginal discs do not scale properly in myo and Actβ 
mutants, it is unknown whether other scaling relationships are lost as well. In 
other words, do imaginal discs in myo and Actβ mutants lose their ability to 
respond to nutritional or temperature changes? Determining the allometric 
coefficient for these mutants will be more informative on how this ligands control 
scaling. 
Another important question is how cells respond to stimulation by different 
ligands? Both, Myo and Actβ signaling activate dSmad2, the signal transducer 
and transcription factor. Thus, the obvious question is whether pathway 
activation by Actβ in muscles have a different transcriptional output than Myo 
signaling in imaginal discs. This would help answer whether growth of these two 
organs controlled by similar or different mechanisms. 
  170 
Lastly, the ability of a cell to respond to either Myo, Actβ, or Daw depends 
on the expression of a specific isoform of the ligand binding type-I receptor, 
Babo. Certain organs like the wing imaginal discs express a isoform Babo-a, 
whereas the fat-body expresses Babo-c. Thus, defects in isoform expression 
likely results in phenotypes similar to specific ligand mutants. Identifying splicing 
regulators that enable expression of specific isoform will shed light on how these 
systemic ligands yield tissue specific response.  
 Figure 4-1. Model of wing/muscle scaling via Myo signaling 
Wings scaling with respect to body size and muscles (depicted here as thorax 
cross section) is isometric (white line). Deviation from the white line leads to 
ectopically large muscles (lower line) or wings (top line). Myo signaling from the 
muscles restores the misbalance. Although, not directly, Actβ promotes body size 
and muscle growth and supporting the scaling of wings to body size. 
 
  
  171 
REFRENCES 
Aberle, H., Haghighi, A. P., Fetter, R. D., McCabe, B. D., Magalhães, T. R. and Goodman, C. 
S. (2002). wishful thinking encodes a BMP type II receptor that regulates synaptic growth in 
Drosophila. Neuron 33, 545–558. 
Affolter, M. and Basler, K. (2007). The Decapentaplegic morphogen gradient: from pattern 
formation to growth regulation. Nat. Rev. Genet. 8, 663–74. 
Akiyama, T. and Gibson, M. C. (2015). Decapentaplegic and growth control in the developing 
Drosophila wing. Nature 527, 375–378. 
Akiyama, T., Kamimura, K., Firkus, C., Takeo, S., Shimmi, O. and Nakato, H. (2008). Dally 
regulates Dpp morphogen gradient formation by stabilizing Dpp on the cell surface. Dev. 
Biol. 313, 408–19. 
Akiyama, T., Marqués, G. and Wharton, K. A. (2012). A large bioactive BMP ligand with distinct 
signaling properties is produced by alternative proconvertase processing. Sci. Signal. 5, 
ra28. 
Alarcón, C., Zaromytidou, A.-I., Xi, Q., Gao, S., Yu, J., Fujisawa, S., Barlas, A., Miller, A. N., 
Manova-Todorova, K., Macias, M. J., et al. (2009). Nuclear CDKs drive Smad 
transcriptional activation and turnover in BMP and TGF-beta pathways. Cell 139, 757–69. 
Aldaz, S. and Escudero, L. M. (2010). Imaginal discs. Curr. Biol. 20, R429–R431. 
Amore, G. and Casares, F. (2010). Size matters: the contribution of cell proliferation to the 
progression of the specification Drosophila eye gene regulatory network. Dev. Biol. 344, 
569–77. 
Arbouzova, N. I. and Zeidler, M. P. (2006). JAK/STAT signalling in Drosophila: insights into 
conserved regulatory and cellular functions. Development 133, 2605–16. 
Augustin, H., McGourty, K., Steinert, J. R., Cochemé, H. M., Adcott, J., Cabecinha, M., 
Vincent, A., Halff, E. F., Kittler, J. T., Boucrot, E., et al. (2017). Myostatin-like proteins 
regulate synaptic function and neuronal morphology. Development 144, 2445–2455. 
Awasaki, T., Huang, Y., O’Connor, M. B. and Lee, T. (2011). Glia instruct developmental 
neuronal remodeling through TGF-β signaling. Nat. Neurosci. 14, 821–3. 
Baena-Lopez, L. A., Nojima, H. and Vincent, J.-P. (2012). Integration of morphogen signalling 
within the growth regulatory network. Curr. Opin. Cell Biol. 24, 166–72. 
Bai, H., Kang, P., Hernandez, A. M. and Tatar, M. (2013). Activin Signaling Targeted by 
Insulin/dFOXO Regulates Aging and Muscle Proteostasis in Drosophila. PLoS Genet. 9, 
e1003941. 
Baines, R. A. (2004). Synaptic strengthening mediated by bone morphogenetic protein-
dependent retrograde signaling in the Drosophila CNS. J. Neurosci. 24, 6904–11. 
Baker, N. E. (2001). Cell proliferation, survival, and death in the Drosophila eye. Semin. Cell Dev. 
Biol. 12, 499–507. 
Ball, R. W., Warren-Paquin, M., Tsurudome, K., Liao, E. H., Elazzouzi, F., Cavanagh, C., An, 
B. S., Wang, T. T., White, J. H. and Haghighi, A. P. (2010). Retrograde BMP signaling 
controls synaptic growth at the NMJ by regulating trio expression in motor neurons. Neuron 
66, 536–549. 
Ballard, S. L., Jarolimova, J. and Wharton, K. A. (2010). Gbb/BMP signaling is required to 
  172 
maintain energy homeostasis in Drosophila. Dev. Biol. 337, 375–85. 
Belenkaya, T. Y., Han, C., Yan, D., Opoka, R. J., Khodoun, M., Liu, H. and Lin, X. (2004). 
Drosophila Dpp morphogen movement is independent of dynamin-mediated endocytosis 
but regulated by the glypican members of heparan sulfate proteoglycans. Cell 119, 231–44. 
Ben-Zvi, D., Pyrowolakis, G., Barkai, N. and Shilo, B.-Z. (2011). Expansion-repression 
mechanism for scaling the Dpp activation gradient in Drosophila wing imaginal discs. Curr. 
Biol. 21, 1391–6. 
Benkel, B. F. and Hickey, D. A. (1986). Glucose Repression of Amylase Gene Expression in 
DROSOPHILA MELANOGASTER. Genetics 114, 137–44. 
Berke, B., Wittnam, J., McNeill, E., Van Vactor, D. L. and Keshishian, H. (2013). Retrograde 
BMP signaling at the synapse: a permissive signal for synapse maturation and activity-
dependent plasticity. J Neurosci 33, 17937–17950. 
Bertolino, P., Holmberg, R., Reissmann, E., Andersson, O., Berggren, P.-O. and Ibáñez, C. 
F. (2008). Activin B receptor ALK7 is a negative regulator of pancreatic β-cell function. Proc. 
Natl. Acad. Sci. U. S. A. 105, 7246–7251. 
Bickel, D., Shah, R., Gesualdi, S. C. and Haerry, T. E. (2008). Drosophila Follistatin exhibits 
unique structural modifications and interacts with several TGF-beta family members. Mech. 
Dev. 125, 117–29. 
Böhni, R., Riesgo-Escovar, J., Oldham, S., Brogiolo, W., Stocker, H., Andruss, B. F., 
Beckingham, K. and Hafen, E. (1999). Autonomous control of cell and organ size by 
CHICO, a Drosophila homolog of vertebrate IRS1-4. Cell 97, 865–75. 
Boulan, L., Milán, M. and Léopold, P. (2015). The Systemic Control of Growth. Cold Spring 
Harb. Perspect. Biol. 7,. 
Brakefield, P. M. (2006). Evo-devo and constraints on selection. Trends Ecol. Evol. 21, 362–8. 
Brogiolo, W., Stocker, H., Ikeya, T., Rintelen, F., Fernandez, R. and Hafen, E. (2001). An 
evolutionarily conserved function of the Drosophila insulin receptor and insulin-like peptides 
in growth control. Curr. Biol. 11, 213–21. 
Browder, M. H., D’Amico, L. J. and Nijhout, H. F. (2001). The role of low levels of juvenile 
hormone esterase in the metamorphosis of Manduca sexta. J. Insect Sci. 1, 11. 
Brummel, T. J., Twombly, V., Marqués, G., Wrana, J. L., Newfeld, S. J., Attisano, L., 
Massagué, J., O’Connor, M. B. and Gelbart, W. M. (1994). Characterization and 
relationship of Dpp receptors encoded by the saxophone and thick veins genes in 
Drosophila. Cell 78, 251–61. 
Brummel, T., Abdollah, S., Haerry, T. E., Shimell, M. J., Merriam, J., Raftery, L., Wrana, J. L. 
and O’Connor, M. B. (1999). The Drosophila Activin receptor Baboon signals through 
dSmad2 and controls cell proliferation but not patterning during larval development. Genes 
Dev. 13, 98–111. 
Bryant, P. J. and Simpson, P. (1984). Intrinsic and Extrinsic Control of Growth in Developing 
Organs. Q. Rev. Biolgoy 59, 387–415. 
Caldwell, P. E., Walkiewicz, M. and Stern, M. (2005). Ras activity in the Drosophila prothoracic 
gland regulates body size and developmental rate via ecdysone release. Curr. Biol. 15, 
1785–95. 
Campbell, G. and Tomlinson,  a (1999). Transducing the Dpp morphogen gradient in the wing 
of Drosophila: regulation of Dpp targets by brinker. Cell 96, 553–62. 
  173 
Chambers, A. P., Sandoval, D. A. and Seeley, R. J. (2013). Integration of satiety signals by the 
central nervous system. Curr. Biol. 23, R379-88. 
Chantranupong, L., Scaria, S. M., Saxton, R. A., Gygi, M. P., Shen, K., Wyant, G. A., Wang, 
T., Harper, J. W., Gygi, S. P. and Sabatini, D. M. (2016). The CASTOR Proteins Are 
Arginine Sensors for the mTORC1 Pathway. Cell 165, 153–164. 
Chen, C., Jack, J. and Garofalo, R. S. (1996). The Drosophila insulin receptor is required for 
normal growth. Endocrinology 137, 846–856. 
Chen, J., Honeyager, S. M., Schleede, J., Avanesov, A., Laughon, A. and Blair, S. S. (2012). 
Crossveinless d is a vitellogenin-like lipoprotein that binds BMPs and HSPGs, and is 
required for normal BMP signaling in the Drosophila wing. Development 139, 2170–6. 
Chien, S., Reiter, L. T., Bier, E. and Gribskov, M. (2002). Homophila: human disease gene 
cognates in Drosophila. Nucleic Acids Res. 30, 149–51. 
Chng, W. A., Sleiman, M. S. B., Schüpfer, F. and Lemaitre, B. (2014). Transforming growth 
factor β/activin signaling functions as a sugar-sensing feedback loop to regulate digestive 
enzyme expression. Cell Rep. 9, 336–348. 
Church, R. B. and Robertson, F. W. (1966). A biochemical study of the growth ofDrosophila 
melanogaster. J. Exp. Zool. 162, 337–351. 
Colombani, J., Raisin, S., Pantalacci, S., Radimerski, T., Montagne, J. and Léopold, P. 
(2003). A nutrient sensor mechanism controls Drosophila growth. Cell 114, 739–49. 
Colombani, J., Andersen, D. S. and Léopold, P. (2012). Secreted peptide Dilp8 coordinates 
Drosophila tissue growth with developmental timing. Science 336, 582–5. 
Conley, C. a, Silburn, R., Singer, M. a, Ralston,  a, Rohwer-Nutter, D., Olson, D. J., Gelbart, 
W. and Blair, S. S. (2000). Crossveinless 2 contains cysteine-rich domains and is required 
for high levels of BMP-like activity during the formation of the cross veins in Drosophila. 
Development 127, 3947–59. 
Crick, F. (1970). Diffusion in Embryogenesis. Nature 225, 420–422. 
Curtiss, J. and Mlodzik, M. (2000). Morphogenetic furrow initiation and progression during eye 
development in Drosophila: the roles of decapentaplegic, hedgehog and eyes absent. 
Development 127, 1325–36. 
Dani, N. and Broadie, K. (2012). Glycosylated synaptomatrix regulation of trans-synaptic 
signaling. Dev Neurobiol 72, 2–21. 
Day, S. J. and Lawrence, P. A. (2000). Measuring dimensions: the regulation of size and shape. 
Development 127, 2977–87. 
de Celis, J. F. (2003). Pattern formation in the Drosophila wing: The development of the veins. 
Bioessays 25, 443–51. 
de Celis, J. F., Bray, S. and Garcia-Bellido,  a (1997). Notch signalling regulates veinlet 
expression and establishes boundaries between veins and interveins in the Drosophila 
wing. Development 124, 1919–28. 
De Loof, A., Vandersmissen, T., Marchal, E. and Schoofs, L. (2015). Initiation of 
metamorphosis and control of ecdysteroid biosynthesis in insects: The interplay of absence 
of Juvenile hormone, PTTH, and Ca(2+)-homeostasis. Peptides 68, 120–9. 
Delanoue, R., Slaidina, M. and Léopold, P. (2010). The steroid hormone ecdysone controls 
systemic growth by repressing dMyc function in Drosophila fat cells. Dev. Cell 18, 1012–21. 
  174 
Demontis, F. and Perrimon, N. (2009). Integration of Insulin receptor/Foxo signaling and dMyc 
activity during muscle growth regulates body size in Drosophila. Development 136, 983–93. 
Demontis, F., Patel, V. K., Swindell, W. R. and Perrimon, N. (2014). Intertissue control of the 
nucleolus via a myokine-dependent longevity pathway. Cell Rep. 7, 1481–1494. 
Derynck, R., Gelbart, W. M., Harland, R. M., Heldin, C. H., Kern, S. E., Massagué, J., Melton, 
D. A., Mlodzik, M., Padgett, R. W., Roberts, A. B., et al. (1996). Nomenclature: vertebrate 
mediators of TGFbeta family signals. Cell 87, 173. 
Dickinson, M. H., Lehmann, F. O. and Sane, S. P. (1999). Wing rotation and the aerodynamic 
basis of insect flight. Science 284, 1954–60. 
Dickson, B. J. (2001). Rho GTPases in growth cone guidance. Curr Opin Neurobiol 11, 103–
110. 
Droujinine, I. A. and Perrimon, N. (2016). Interorgan Communication Pathways in Physiology: 
Focus on Drosophila. Annu. Rev. Genet. 50, 539–570. 
Dutta, D., Anant, S., Ruiz-Gomez, M., Bate, M. and VijayRaghavan, K. (2004). Founder 
myoblasts and fibre number during adult myogenesis in Drosophila. Development 131, 
3761–3772. 
Eaton, B. A. and Davis, G. W. (2005). LIM Kinase1 controls synaptic stability downstream of the 
type II BMP receptor. Neuron 47, 695–708. 
Eckel, R. H., Grundy, S. M. and Zimmet, P. Z. (2005). The metabolic syndrome. Lancet 365, 
1415–1428. 
Eivers, E., Fuentealba, L. C., Sander, V., Clemens, J. C., Hartnett, L. and De Robertis, E. M. 
(2009). Mad is required for wingless signaling in wing development and segment patterning 
in Drosophila. PLoS One 4, e6543. 
Eivers, E., Demagny, H., Choi, R. H. and De Robertis, E. M. (2011). Phosphorylation of Mad 
controls competition between wingless and BMP signaling. Sci. Signal. 4, ra68. 
Elashry, M. I., Otto, A., Matsakas, A., El-Morsy, S. E. and Patel, K. (2009). Morphology and 
myofiber composition of skeletal musculature of the forelimb in young and aged wild type 
and myostatin null mice. Rejuvenation Res. 12, 269–81. 
Elkasrawy, M. N. and Hamrick, M. W. (2010). Myostatin (GDF-8) as a key factor linking muscle 
mass and bone structure. J. Musculoskelet. Neuronal Interact. 10, 56–63. 
Entchev, E. V, Schwabedissen,  a and González-Gaitán, M. (2000). Gradient formation of the 
TGF-beta homolog Dpp. Cell 103, 981–91. 
Estella, C. and Mann, R. S. (2008). Logic of Wg and Dpp induction of distal and medial fates in 
the Drosophila leg. Development 135, 627–36. 
Estella, C., Voutev, R. and Mann, R. S. (2012). A dynamic network of morphogens and 
transcription factors patterns the fly leg. 1st ed. Elsevier Inc. 
Estrada, B., Casares, F. and Sánchez-Herrero, E. (2003). Development of the genitalia in 
Drosophila melanogaster. Differentiation 71, 299–310. 
Ewing, A. W. (1964). The influence of wing area on the courtship behaviour of Drosophila 
melanogaster. Anim. Behav. 12, 316–320. 
Fan, X., Labrador, J. P., Hing, H. and Bashaw, G. J. (2003). Slit stimulation recruits Dock and 
Pak to the roundabout receptor and increases Rac activity to regulate axon repulsion at the 
CNS midline. Neuron 40, 113–127. 
  175 
Farkas, J. E. and Monaghan, J. R. (2017). A brief history of the study of nerve dependent 
regeneration. Neurogenes. (Austin, Tex.) 4, e1302216. 
Firth, L. C., Bhattacharya, A. and Baker, N. E. (2010). Cell cycle arrest by a gradient of Dpp 
signaling during Drosophila eye development. BMC Dev. Biol. 10, 28. 
Frankino, W. A., Emlen, D. J. and Shingleton, A. W. (2009). Experimental Approaches to 
Studying the Evolution of Animal Form. In Experimental Evolution: Concepts, Methods and 
Applications of Selection Experiments, pp. 419–478. 
Fritsch, C., Sawala, A., Harris, R., Maartens, A., Sutcliffe, C., Ashe, H. L. and Ray, R. P. 
(2012). Different requirements for proteolytic processing of bone morphogenetic protein 
5/6/7/8 ligands in Drosophila melanogaster. J. Biol. Chem. 287, 5942–53. 
Fuentes-Medel, Y., Ashley, J., Barria, R., Maloney, R., Freeman, M. and Budnik, V. (2012). 
Integration of a retrograde signal during synapse formation by glia-secreted TGF-beta 
ligand. Curr Biol 22, 1831–1838. 
Fujise, M., Takeo, S., Kamimura, K., Matsuo, T., Aigaki, T., Izumi, S. and Nakato, H. (2003). 
Dally regulates Dpp morphogen gradient formation in the Drosophila wing. Development 
130, 1515–1522. 
Garland, T. and Carter, P. A. (1994). Evolutionary physiology. Annu. Rev. Physiol. 56, 579–621. 
Gesualdi, S. C. and Haerry, T. E. (2007). Distinct signaling of Drosophila Activin/TGF-beta 
family members. Fly (Austin). 1, 212–21. 
Ghosh, A. C. and O’Connor, M. B. (2014). Systemic Activin signaling independently regulates 
sugar homeostasis, cellular metabolism, and pH balance in Drosophila melanogaster. Proc. 
Natl. Acad. Sci. U. S. A. 111, 5729–34. 
Gibbens, Y. Y., Warren, J. T., Gilbert, L. I. and O’Connor, M. B. (2011). Neuroendocrine 
regulation of Drosophila metamorphosis requires TGFbeta/Activin signaling. Development 
138, 2693–2703. 
Gilbert, L. I. (2004). Halloween genes encode P450 enzymes that mediate steroid hormone 
biosynthesis in Drosophila melanogaster. Mol. Cell. Endocrinol. 215, 1–10. 
Gilchrist, G. W. and Huey, R. B. (2004). Plastic and Genetic Variation in Wing Loading as a 
Function of Temperature Within and Among Parallel Clines in Drosophila subobscura. 
Integr. Comp. Biol. 44, 461–70. 
Gilchrist, A. S., Azevedo, R. B., Partridge, L. and O’Higgins, P. (2000). Adaptation and 
constraint in the evolution of Drosophila melanogaster wing shape. Evol. Dev. 2, 114–24. 
Goberdhan, D. C., Paricio, N., Goodman, E. C., Mlodzik, M. and Wilson, C. (1999). Drosophila 
tumor suppressor PTEN controls cell size and number by antagonizing the Chico/PI3-kinase 
signaling pathway. Genes Dev. 13, 3244–58. 
Gokhale, R. H. and Shingleton, A. W. (2015). Size control: the developmental physiology of 
body and organ size regulation. Wiley Interdiscip. Rev. Dev. Biol. 4, 335–56. 
Gokhale, R. H., Hayashi, T., Mirque, C. D. and Shingleton, A. W. (2016). Intra-organ growth 
coordination in Drosophila is mediated by systemic ecdysone signaling. Dev. Biol. 418, 
135–145. 
Goold, C. P. and Davis, G. W. (2007). The BMP ligand Gbb gates the expression of synaptic 
homeostasis independent of synaptic growth control. Neuron 56, 109–123. 
Gould, S. J. (1966). Allometry and size in ontogeny and phylogeny. Biol. Rev. Camb. Philos. 
  176 
Soc. 41, 587–640. 
Gramates, L. S., Marygold, S. J., Santos, G. Dos, Urbano, J.-M., Antonazzo, G., Matthews, 
B. B., Rey, A. J., Tabone, C. J., Crosby, M. A., Emmert, D. B., et al. (2017). FlyBase at 
25: looking to the future. Nucleic Acids Res. 45, D663–D671. 
Grewal, S. S. (2012). Controlling animal growth and body size - does fruit fly physiology point the 
way? F1000 Biol. Rep. 4, 12. 
Grönke, S., Clarke, D.-F., Broughton, S., Andrews, T. D. and Partridge, L. (2010). Molecular 
evolution and functional characterization of Drosophila insulin-like peptides. PLoS Genet. 6, 
e1000857. 
Haerry, T. E., Khalsa, O., O’Connor, M. B. and Wharton, K. a (1998). Synergistic signaling by 
two BMP ligands through the SAX and TKV receptors controls wing growth and patterning 
in Drosophila. Development 125, 3977–87. 
Halder, G. and Johnson, R. L. (2011). Hippo signaling: growth control and beyond. 
Development 138, 9–22. 
Hales, K. G., Korey, C. A., Larracuente, A. M. and Roberts, D. M. (2015). Genetics on the Fly: 
A Primer on the Drosophila Model System. Genetics 201, 815–42. 
Hamaratoglu, F., de Lachapelle, A. M., Pyrowolakis, G., Bergmann, S. and Affolter, M. 
(2011). Dpp signaling activity requires Pentagone to scale with tissue size in the growing 
Drosophila wing imaginal disc. PLoS Biol. 9, e1001182. 
Hamaratoglu, F., Affolter, M. and Pyrowolakis, G. (2014). Dpp/BMP signaling in flies: from 
molecules to biology. Semin. Cell Dev. Biol. 32, 128–36. 
Hariharan, I. K. (2015). Organ Size Control: Lessons from Drosophila. Dev. Cell 34, 255–65. 
Hariharan, I. K., Wake, D. B. and Wake, M. H. (2015). Indeterminate Growth: Could It Represent 
the Ancestral Condition? Cold Spring Harb. Perspect. Biol. 8, a019174. 
Harmansa, S., Hamaratoglu, F., Affolter, M. and Caussinus, E. (2015). Dpp spreading is 
required for medial but not for lateral wing disc growth. Nature 527, 317–22. 
Hata, A. and Chen, Y.-G. (2016). TGF-β Signaling from Receptors to Smads. Cold Spring Harb. 
Perspect. Biol. 8,. 
Heitman, J., Movva, N. R. and Hall, M. N. (1991). Targets for cell cycle arrest by the 
immunosuppressant rapamycin in yeast. Science 253, 905–9. 
Heldin, C.-H. and Moustakas, A. (2016). Signaling Receptors for TGF-β Family Members. Cold 
Spring Harb. Perspect. Biol. 8,. 
Herboso, L., Oliveira, M. M., Talamillo, A., Pérez, C., González, M., Martín, D., Sutherland, J. 
D., Shingleton, A. W., Mirth, C. K. and Barrio, R. (2015). Ecdysone promotes growth of 
imaginal discs through the regulation of Thor in D. melanogaster. Sci. Rep. 5, 12383. 
Hevia, C. F. and de Celis, J. F. (2013). Activation and function of TGFβ signalling during 
Drosophila wing development and its interactions with the BMP pathway. Dev. Biol. 377, 
138–53. 
Hevia, C. F., López-Varea, A., Esteban, N. and de Celis, J. F. (2017). A Search for Genes 
Mediating the Growth Promoting Function of TGFβ in the Drosophila melanogaster Wing 
Disc. Genetics 206, genetics.116.197228. 
Hickey, D. A. and Benkel, B. (1982). Regulation of amylase activity in drosophila melanogaster: 
effects of dietary carbohydrate. Biochem. Genet. 20, 1117–29. 
  177 
Hill, C. S. (2016). Transcriptional Control by the SMADs. Cold Spring Harb. Perspect. Biol. 8,. 
Hirschhorn, J. N. and Lettre, G. (2009). Progress in genome-wide association studies of human 
height. Horm. Res. 71 Suppl 2, 5–13. 
Horsfield, J., Penton,  a, Secombe, J., Hoffman, F. M. and Richardson, H. (1998). 
decapentaplegic is required for arrest in G1 phase during Drosophila eye development. 
Development 125, 5069–78. 
Huang, J., Tian, L., Peng, C., Abdou, M., Wen, D., Wang, Y., Li, S. and Wang, J. (2011). DPP-
mediated TGF  signaling regulates juvenile hormone biosynthesis by activating the 
expression of juvenile hormone acid methyltransferase. Development 138, 2283–2291. 
Huxley, J. (1932). Problems of Relative Growth. London: Methuen & Co. 
Ikeya, T., Galic, M., Belawat, P., Nairz, K. and Hafen, E. (2002). Nutrient-dependent expression 
of insulin-like peptides from neuroendocrine cells in the CNS contributes to growth 
regulation in Drosophila. Curr. Biol. 12, 1293–300. 
Inoue, H., Imamura, T., Ishidou, Y., Takase, M., Udagawa, Y., Oka, Y., Tsuneizumi, K., 
Tabata, T., Miyazono, K. and Kawabata, M. (1998). Interplay of signal mediators of 
decapentaplegic (Dpp): molecular characterization of mothers against dpp, Medea, and 
daughters against dpp. Mol. Biol. Cell 9, 2145–56. 
James, R. E. and Broihier, H. T. (2011). Crimpy inhibits the BMP homolog Gbb in motoneurons 
to enable proper growth control at the Drosophila neuromuscular junction. Development 
138, 3273–3286. 
Jaźwińska,  a, Kirov, N., Wieschaus, E., Roth, S. and Rushlow, C. (1999). The Drosophila 
gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96, 563–73. 
Jensen, P. A., Zheng, X., Lee, T. and O’Connor, M. B. (2009). The Drosophila Activin-like 
ligand Dawdle signals preferentially through one isoform of the Type-I receptor Baboon. 
Mech. Dev. 126, 950–7. 
Jiang, H. and Edgar, B. A. (2009). EGFR signaling regulates the proliferation of Drosophila adult 
midgut progenitors. Development 136, 483–93. 
Johnston, L. A. and Gallant, P. (2002). Control of growth and organ size in Drosophila. 
Bioessays 24, 54–64. 
Kahlem, P. and Newfeld, S. J. (2009). Informatics approaches to understanding TGFbeta 
pathway regulation. Development 136, 3729–40. 
Kalidas, S. and Smith, D. P. (2002). Novel genomic cDNA hybrids produce effective RNA 
interference in adult Drosophila. Neuron 33, 177–84. 
Kamiya, Y., Miyazono, K. and Miyazawa, K. (2008). Specificity of the inhibitory effects of Dad 
on TGF-beta family type I receptors, Thickveins, Saxophone, and Baboon in Drosophila. 
FEBS Lett. 582, 2496–500. 
Karim, F. D. and Rubin, G. M. (1998). Ectopic expression of activated Ras1 induces hyperplastic 
growth and increased cell death in Drosophila imaginal tissues. Development 125, 1–9. 
Keshet, Y. and Seger, R. (2010). The MAP kinase signaling cascades: a system of hundreds of 
components regulates a diverse array of physiological functions. Methods Mol. Biol. 661, 3–
38. 
Kicheva, A. and González-Gaitán, M. (2008). The Decapentaplegic morphogen gradient: a 
precise definition. Curr. Opin. Cell Biol. 20, 137–43. 
  178 
Kim, N. C. and Marques, G. (2012). The Ly6 neurotoxin-like molecule target of wit regulates 
spontaneous neurotransmitter release at the developing neuromuscular junction in 
Drosophila. Dev Neurobiol 72, 1541–1558. 
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon,  a (1997). Drosophila Mad binds to 
DNA and directly mediates activation of vestigial by Decapentaplegic. Nature 388, 304–8. 
Kim, M.-J., O’Connor, M. B. and O’Connor, M. B. (2014). Anterograde Activin signaling 
regulates postsynaptic membrane potential and GluRIIA/B abundance at the Drosophila 
neuromuscular junction. PLoS One 9, e107443. 
King-Jones, K. and Thummel, C. S. (2005). Nuclear receptors--a perspective from Drosophila. 
Nat. Rev. Genet. 6, 311–23. 
Koyama, T. and Mirth, C. K. (2018). Unravelling the diversity of mechanisms through which 
nutrition regulates body size in insects. Curr. Opin. insect Sci. 25, 1–8. 
Kretzschmar, M., Doody, J. and Massagué, J. (1997). Opposing BMP and EGF signalling 
pathways converge on the TGF-beta family mediator Smad1. Nature 389, 618–22. 
Kronenberg, H. M. (2003). Developmental regulation of the growth plate. Nature 423, 332–6. 
Künnapuu, J., Björkgren, I. and Shimmi, O. (2009). The Drosophila DPP signal is produced by 
cleavage of its proprotein at evolutionary diversified furin-recognition sites. Proc. Natl. Acad. 
Sci. U. S. A. 106, 8501–6. 
Künnapuu, J., Tauscher, P. M., Tiusanen, N., Nguyen, M., Löytynoja, A., Arora, K. and 
Shimmi, O. (2014). Cleavage of the Drosophila screw prodomain is critical for a dynamic 
BMP morphogen gradient in embryogenesis. Dev. Biol. 389, 149–59. 
Kuo, I. Y. and Ehrlich, B. E. (2015). Signaling in muscle contraction. Cold Spring Harb. 
Perspect. Biol. 7, a006023. 
Kuo, W.-J., Digman, M. A. and Lander, A. D. (2010). Heparan sulfate acts as a bone 
morphogenetic protein coreceptor by facilitating ligand-induced receptor hetero-
oligomerization. Mol. Biol. Cell 21, 4028–41. 
Lamouille, S. and Derynck, R. (2007). Cell size and invasion in TGF-beta-induced epithelial to 
mesenchymal transition is regulated by activation of the mTOR pathway. J. Cell Biol. 178, 
437–51. 
Lecuit, T. and Cohen, S. M. (1997). Proximal-distal axis formation in the Drosophila leg. Nature 
388, 139–45. 
Lecuit, T., Brook, W., Ng, M., Calleja, M., Sun, H. and Cohen, S. (1996). Two distinct 
mechanisms for long-range patterning by Decapentaplegic in the Drosophila wing. Nature 
381, 387–393. 
Lee-Hoeflich, S. T., Zhao, X., Mehra, A. and Attisano, L. (2005). The Drosophila type II 
receptor, Wishful thinking, binds BMP and myoglianin to activate multiple TGF?? family 
signaling pathways. FEBS Lett. 579, 4615–4621. 
Lee, J. Y., Hopkinson, N. S. and Kemp, P. R. (2011). Myostatin induces autophagy in skeletal 
muscle in vitro. Biochem. Biophys. Res. Commun. 415, 632–6. 
Leevers, S. J., Weinkove, D., MacDougall, L. K., Hafen, E. and Waterfield, M. D. (1996). The 
Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J. 15, 6584–94. 
Letsou, A., Arora, K., Wrana, J. L., Simin, K., Twombly, V., Jamal, J., Staehling-Hampton, 
K., Hoffmann, F. M., Gelbart, W. M. and Massagué, J. (1995). Drosophila Dpp signaling is 
  179 
mediated by the punt gene product: a dual ligand-binding type II receptor of the TGF beta 
receptor family. Cell 80, 899–908. 
Lo, P. C. and Frasch, M. (1999). Sequence and expression of myoglianin, a novel Drosophila 
gene of the TGF-beta superfamily. Mech. Dev. 86, 171–5. 
Lokireddy, S., Wijesoma, I. W., Sze, S. K., McFarlane, C., Kambadur, R. and Sharma, M. 
(2012). Identification of atrogin-1-targeted proteins during the myostatin-induced skeletal 
muscle wasting. Am. J. Physiol. Cell Physiol. 303, C512-29. 
Macias, M. J., Martin-Malpartida, P. and Massagué, J. (2015). Structural determinants of Smad 
function in TGF-β signaling. Trends Biochem. Sci. 40, 296–308. 
Madaan, U., Yzeiraj, E., Meade, M., Clark, J. F., Rushlow, C. A. and Savage-Dunn, C. (2018). 
BMP Signaling Determines Body Size via Transcriptional Regulation of Collagen Genes in 
Caenorhabditis elegans. Genetics 210, 1355–1367. 
Makhijani, K., Alexander, B., Rao, D., Petraki, S., Herboso, L., Kukar, K., Batool, I., 
Wachner, S., Gold, K. S., Wong, C., et al. (2017). Regulation of Drosophila hematopoietic 
sites by Activin-β from active sensory neurons. Nat. Commun. 8, 15990. 
Marqués, G., Bao, H., Haerry, T. E., Shimell, M. J., Duchek, P., Zhang, B. and O’Connor, M. 
B. (2002). The Drosophila BMP type II receptor Wishful Thinking regulates neuromuscular 
synapse morphology and function. Neuron 33, 529–43. 
Martín-Castellanos, C. and Edgar, B. a (2002). A characterization of the effects of Dpp 
signaling on cell growth and proliferation in the Drosophila wing. Development 129, 1003–
1013. 
Martin, F. A., Herrera, S. C. and Morata, G. (2009). Cell competition, growth and size control in 
the Drosophila wing imaginal disc. Development 136, 3747–3756. 
Martín, F. a, Pérez-Garijo, A., Moreno, E. and Morata, G. (2004). The brinker gradient controls 
wing growth in Drosophila. Development 131, 4921–4930. 
Matsakas, A., Otto, A., Elashry, M. I., Brown, S. C. and Patel, K. (2010). Altered primary and 
secondary myogenesis in the myostatin-null mouse. Rejuvenation Res. 13, 717–27. 
Matsuda, S. and Shimmi, O. (2012). Directional transport and active retention of Dpp/BMP 
create wing vein patterns in Drosophila. Dev. Biol. 366, 153–62. 
Mattila, J., Havula, E., Suominen, E., Teesalu, M., Surakka, I., Hynynen, R., Kilpinen, H., 
Väänänen, J., Hovatta, I., Käkelä, R., et al. (2015). Mondo-Mlx Mediates Organismal 
Sugar Sensing through the Gli-Similar Transcription Factor Sugarbabe. Cell Rep. 350–364. 
McBrayer, Z., Ono, H., Shimell, M., Parvy, J.-P., Beckstead, R. B., Warren, J. T., Thummel, 
C. S., Dauphin-Villemant, C., Gilbert, L. I. and O’Connor, M. B. (2007). 
Prothoracicotropic hormone regulates developmental timing and body size in Drosophila. 
Dev. Cell 13, 857–71. 
McCabe, J. and Partridge, L. (1997). AN INTERACTION BETWEEN ENVIRONMENTAL 
TEMPERATURE AND GENETIC VARIATION FOR BODY SIZE FOR THE FITNESS OF 
ADULT FEMALE DROSOPHILA MELANOGASTER. Evolution (N. Y). 51, 1164–1174. 
McCabe, B. D., Marqués, G., Haghighi, A. P., Fetter, R. D., Crotty, M. L., Haerry, T. E., 
Goodman, C. S. and O’Connor, M. B. (2003). The BMP homolog Gbb provides a 
retrograde signal that regulates synaptic growth at the Drosophila neuromuscular junction. 
Neuron 39, 241–254. 
McCabe, B. D., Hom, S., Aberle, H., Fetter, R. D., Marques, G., Haerry, T. E., Wan, H., 
  180 
O’Connor, M. B., Goodman, C. S. and Haghighi, A. P. (2004). Highwire regulates 
presynaptic BMP signaling essential for synaptic growth. Neuron 41, 891–905. 
McNabb, S. L., Baker, J. D., Agapite, J., Steller, H., Riddiford, L. M. and Truman, J. W. 
(1997). Disruption of a behavioral sequence by targeted death of peptidergic neurons in 
Drosophila. Neuron 19, 813–23. 
McPherron, A. C. and Lee, S. J. (1997). Double muscling in cattle due to mutations in the 
myostatin gene. Proc. Natl. Acad. Sci. U. S. A. 94, 12457–61. 
McPherron, A. C., Lawler, A. M. and Lee, S. J. (1997). Regulation of skeletal muscle mass in 
mice by a new TGF-beta superfamily member. Nature 387, 83–90. 
Milán, M., Campuzano, S. and García-Bellido, A. (1996). Cell cycling and patterned cell 
proliferation in the wing primordium of Drosophila. Proc. Natl. Acad. Sci. U. S. A. 93, 640–5. 
Minami, M., Kinoshita, N., Kamoshida, Y., Tanimoto, H. and Tabata, T. (1999). brinker is a 
target of Dpp in Drosophila that negatively regulates Dpp-dependent genes. Nature 398, 
242–6. 
Mirth, C. K. and Shingleton, A. W. (2012). Integrating body and organ size in Drosophila: 
Recent advances and outstanding problems. Front. Endocrinol. (Lausanne). 3, 1–13. 
Mirth, C. K. and Shingleton, A. W. (2014). The roles of juvenile hormone, insulin/target of 
rapamycin, and ecydsone signaling in regulating body size in Drosophila. Commun. Integr. 
Biol. 7,. 
Mirth, C. K., Truman, J. W. and Riddiford, L. M. (2009). The Ecdysone receptor controls the 
post-critical weight switch to nutrition-independent differentiation in Drosophila wing imaginal 
discs. Development 136, 2345–2353. 
Mirth, C. K., Tang, H. Y., Makohon-Moore, S. C., Salhadar, S., Gokhale, R. H., Warner, R. D., 
Koyama, T., Riddiford, L. M. and Shingleton, A. W. (2014). Juvenile hormone regulates 
body size and perturbs insulin signaling in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 111, 
7018–23. 
Morata, G. and Lawrence, P. A. (1977). The development of wingless, a homeotic mutation of 
Drosophila. Dev. Biol. 56, 227–40. 
Morikawa, M., Derynck, R. and Miyazono, K. (2016). TGF-β and the TGF-β Family: Context-
Dependent Roles in Cell and Tissue Physiology. Cold Spring Harb. Perspect. Biol. 8, 
a021873. 
Moss-Taylor, L., Upadhyay, A., Pan, X., Kim, M.-J. and O’Connor, M. B. (2019). Motoneuron-
derived Activinβ regulates Drosophila body size and tissue-scaling during larval growth and 
adult development. bioRxiv 661363. 
Müller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and Basler, K. (2003). Conversion of 
an extracellular Dpp/BMP morphogen gradient into an inverse transcriptional gradient. Cell 
113, 221–33. 
Musselman, L. P., Fink, J. L., Narzinski, K., Ramachandran, P. V., Hathiramani, S. S., 
Cagan, R. L. and Baranski, T. J. (2011). A high-sugar diet produces obesity and insulin 
resistance in wild-type Drosophila. Dis. Model. Mech. 4, 842–9. 
Na, J., Musselman, L. P., Pendse, J., Baranski, T. J., Bodmer, R., Ocorr, K. and Cagan, R. 
(2013). A Drosophila model of high sugar diet-induced cardiomyopathy. PLoS Genet. 9, 
e1003175. 
Nahm, M., Kim, S., Paik, S. K., Lee, M., Lee, S., Lee, Z. H., Kim, J., Lee, D. and Bae, Y. C. 
  181 
(2010). dCIP4 (Drosophila Cdc42-interacting protein 4) restrains synaptic growth by 
inhibiting the secretion of the retrograde Glass bottom boat signal. J Neurosci 30, 8138–
8150. 
Nakae, J., Kido, Y. and Accili, D. (2001). Distinct and overlapping functions of insulin and IGF-I 
receptors. Endocr. Rev. 22, 818–35. 
Nellen, D., Burke, R., Struhl, G. and Basler, K. (1996). Direct and long-range action of a DPP 
morphogen gradient. Cell 85, 357–68. 
Ng, J. (2008). TGF-beta signals regulate axonal development through distinct Smad-independent 
mechanisms. Development 135, 4025–35. 
Ng, M., Diaz-Benjumea, F. J., Vincent, J. P., Wu, J. and Cohen, S. M. (1996). Specification of 
the wing by localized expression of wingless protein. Nature 381, 316–8. 
Nijhout, H. F. (2003). The control of body size in insects. Dev. Biol. 261, 1–9. 
Nijhout, H. F. and Callier, V. (2015). Developmental mechanisms of body size and wing-body 
scaling in insects. Annu. Rev. Entomol. 60, 141–56. 
Nijhout, H. F. and Grunert, L. W. (2010). The Cellular and Physiological Mechanism of Wing-
Body Scaling in Manduca sexta. Science (80-. ). 330, 1693–1695. 
Nijhout, H. F., Riddiford, L. M., Mirth, C., Shingleton, A. W., Suzuki, Y. and Callier, V. (2014). 
The developmental control of size in insects. Wiley Interdiscip. Rev. Dev. Biol. 3, 113–134. 
Norman, M., Vuilleumier, R., Springhorn, A., Gawlik, J. and Pyrowolakis, G. (2016). 
Pentagone internalises glypicans to fine-tune multiple signalling pathways. Elife 5,. 
Nylin, S. and Gotthard, K. (1998). Plasticity in Life-History Traits. Annu. Rev. Entomol. 43, 63–
83. 
O’Connor, M. B., Umulis, D., Othmer, H. G. and Blair, S. S. (2006). Shaping BMP morphogen 
gradients in the Drosophila embryo and pupal wing. Development 133, 183–93. 
Oconnor-Giles, K. M., Ho, L. L. and Ganetzky, B. (2008). Nervous wreck interacts with 
thickveins and the endocytic machinery to attenuate retrograde BMP signaling during 
synaptic growth. Neuron 58, 507–518. 
Ogiso, Y., Tsuneizumi, K., Masuda, N., Sato, M. and Tabata, T. (2011). Robustness of the Dpp 
morphogen activity gradient depends on negative feedback regulation by the inhibitory 
Smad, Dad. Dev. Growth Differ. 53, 668–78. 
Oh, H. and Irvine, K. D. (2010). Yorkie: the final destination of Hippo signaling. Trends Cell Biol. 
20, 410–7. 
Oh, H. and Irvine, K. D. (2011). Cooperative regulation of growth by Yorkie and Mad through 
bantam. Dev. Cell 20, 109–22. 
Oldham, S., Montagne, J., Radimerski, T., Thomas, G. and Hafen, E. (2000). Genetic and 
biochemical characterization of dTOR, the Drosophila homolog of the target of rapamycin. 
Genes Dev. 14, 2689–94. 
Park, D., Veenstra, J. A., Park, J. H. and Taghert, P. H. (2008). Mapping peptidergic cells in 
Drosophila: where DIMM fits in. PLoS One 3, e1896. 
Parker, N. F. and Shingleton, A. W. (2011). The coordination of growth among Drosophila 
organs in response to localized growth-perturbation. Dev. Biol. 357, 318–25. 
Parker, L., Ellis, J. E., Nguyen, M. Q. and Arora, K. (2006). The divergent TGF-β ligand Dawdle 
  182 
utilizes an activin pathway to influence axon guidance in Drosophila. Development 133, 
4981–4991. 
Pentek, J., Parker, L., Wu, A. and Arora, K. (2009). Follistatin preferentially antagonizes activin 
rather than BMP signaling in Drosophila. Genesis 47, 261–73. 
Penzo-Méndez, A. I. and Stanger, B. Z. (2015). Organ-Size Regulation in Mammals. Cold 
Spring Harb. Perspect. Biol. 7,. 
Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M. (2003). Integration of IGF, FGF, and 
anti-BMP signals via Smad1 phosphorylation in neural induction. Genes Dev. 17, 3023–8. 
Peterson, A. J. and O’Connor, M. B. (2013). Activin receptor inhibition by Smad2 regulates 
Drosophila wing disc patterning through BMP-response elements. Development 140, 649–
59. 
Peterson, A. J. and O’Connor, M. B. (2014). Strategies for exploring TGF-β signaling in 
Drosophila. Methods 68, 183–93. 
Peterson, A. J., Jensen, P. A., Shimell, M., Stefancsik, R., Wijayatonge, R., Herder, R., 
Raftery, L. A. and O’Connor, M. B. (2012). R-Smad competition controls activin receptor 
output in Drosophila. PLoS One 7, e36548. 
Piccioli, Z. D. and Littleton, J. T. (2014). Retrograde BMP signaling modulates rapid activity-
dependent synaptic growth via presynaptic LIM kinase regulation of cofilin. J Neurosci 34, 
4371–4381. 
Pinal, N., Calleja, M. and Morata, G. (2019). Pro-apoptotic and pro-proliferation functions of the 
JNK pathway of Drosophila: roles in cell competition, tumorigenesis and regeneration. Open 
Biol. 9, 180256. 
Prober, D. A. and Edgar, B. A. (2000). Ras1 promotes cellular growth in the Drosophila wing. 
Cell 100, 435–46. 
Prokop, A. (2006). Organization of the efferent system and structure of neuromuscular junctions 
in Drosophila. Int. Rev. Neurobiol. 75, 71–90. 
Prokop, A. and Meinertzhagen, I. A. (2006). Development and structure of synaptic contacts in 
Drosophila. Semin. Cell Dev. Biol. 17, 20–30. 
Quianzon, C. C. and Cheikh, I. (2012). History of insulin. J. community Hosp. Intern. Med. 
Perspect. 2,. 
Ralston, A. and Blair, S. S. (2005). Long-range Dpp signaling is regulated to restrict BMP 
signaling to a crossvein competent zone. Dev. Biol. 280, 187–200. 
Ramírez-Weber, F. a and Kornberg, T. B. (1999). Cytonemes: cellular processes that project to 
the principal signaling center in Drosophila imaginal discs. Cell 97, 599–607. 
Rauskolb, C., Sun, S., Sun, G., Pan, Y. and Irvine, K. D. (2014). Cytoskeletal tension inhibits 
Hippo signaling through an Ajuba-Warts complex. Cell 158, 143–156. 
Rawson, J. M., Lee, M., Kennedy, E. L. and Selleck, S. B. (2003). Drosophila neuromuscular 
synapse assembly and function require the TGF-beta type I receptor saxophone and the 
transcription factor Mad. J Neurobiol 55, 134–150. 
Recasens-Alvarez, C., Ferreira, A. and Milán, M. (2017). JAK/STAT controls organ size and 
fate specification by regulating morphogen production and signalling. Nat. Commun. 8, 
13815. 
Ren, X., Sun, J., Housden, B. E., Hu, Y., Roesel, C., Lin, S., Liu, L.-P., Yang, Z., Mao, D., 
  183 
Sun, L., et al. (2013). Optimized gene editing technology for Drosophila melanogaster using 
germ line-specific Cas9. Proc. Natl. Acad. Sci. U. S. A. 110, 19012–7. 
Restrepo, S., Zartman, J. J. and Basler, K. (2014). Coordination of patterning and growth by 
the morphogen DPP. Curr. Biol. 24, R245–R255. 
Rewitz, K. F., Yamanaka, N., Gilbert, L. I. and O’Connor, M. B. (2009). The insect 
neuropeptide PTTH activates receptor tyrosine kinase torso to initiate metamorphosis. 
Science 326, 1403–5. 
Rewitz, K. F., Yamanaka, N. and O’Connor, M. B. (2013). Developmental checkpoints and 
feedback circuits time insect maturation. Curr. Top. Dev. Biol. 103, 1–33. 
Riddiford, L. M. (1993). Hormone receptors and the regulation of insect metamorphosis. 
Receptor 3, 203–9. 
Riddiford, L. M., Truman, J. W., Mirth, C. K. and Shen, Y.-C. (2010). A role for juvenile 
hormone in the prepupal development of Drosophila melanogaster. Development 137, 
1117–26. 
Rodgers, B. D. and Eldridge, J. A. (2015). Reduced circulating GDF11 is unlikely responsible 
for age-dependent changes in mouse heart, muscle, and brain. Endocrinology 156, 3885–
3888. 
Rodriguez, J., Vernus, B., Chelh, I., Cassar-Malek, I., Gabillard, J. C., Hadj Sassi, A., Seiliez, 
I., Picard, B. and Bonnieu, A. (2014). Myostatin and the skeletal muscle atrophy and 
hypertrophy signaling pathways. Cell. Mol. Life Sci. 71, 4361–71. 
Rosenfeld, L. (2002). Insulin: discovery and controversy. Clin. Chem. 48, 2270–88. 
Roy, S., Hsiung, F. and Kornberg, T. B. (2011). Specificity of Drosophila cytonemes for distinct 
signaling pathways. Science 332, 354–8. 
Roy, S., Huang, H., Liu, S. and Kornberg, T. B. (2014). Cytoneme-mediated contact-dependent 
transport of the Drosophila decapentaplegic signaling protein. Science 343, 1244624. 
Rulifson, E. J., Kim, S. K. and Nusse, R. (2002). Ablation of insulin-producing neurons in flies: 
growth and diabetic phenotypes. Science 296, 1118–20. 
Ryoo, H. D., Gorenc, T. and Steller, H. (2004). Apoptotic cells can induce compensatory cell 
proliferation through the JNK and the Wingless signaling pathways. Dev. Cell 7, 491–501. 
Sabatini, D. M. (2017). Twenty-five years of mTOR: Uncovering the link from nutrients to growth. 
Proc. Natl. Acad. Sci. U. S. A. 114, 11818–11825. 
Saitoh, M., Shirakihara, T., Fukasawa, A., Horiguchi, K., Sakamoto, K., Sugiya, H., Beppu, 
H., Fujita, Y., Morita, I., Miyazono, K., et al. (2013). Basolateral BMP Signaling in 
Polarized Epithelial Cells. PLoS One 8, e62659. 
Sánchez, L. and Guerrero, I. (2001). The development of the Drosophila genital disc. BioEssays 
23, 698–707. 
Sánchez, L., Gorfinkiel, N. and Guerrero, I. (2001). Sex determination genes control the 
development of the Drosophila genital disc, modulating the response to Hedgehog, 
Wingless and Decapentaplegic signals. Development 128, 1033–1043. 
Sander, V., Eivers, E., Choi, R. H. and De Robertis, E. M. (2010). Drosophila Smad2 opposes 
Mad signaling during wing vein development. PLoS One 5, e10383. 
Santabárbara-Ruiz, P., López-Santillán, M., Martínez-Rodríguez, I., Binagui-Casas, A., 
Pérez, L., Milán, M., Corominas, M. and Serras, F. (2015). ROS-Induced JNK and p38 
  184 
Signaling Is Required for Unpaired Cytokine Activation during Drosophila Regeneration. 
PLoS Genet. 11, e1005595. 
Sartori, R., Schirwis, E., Blaauw, B., Bortolanza, S., Zhao, J., Enzo, E., Stantzou, A., 
Mouisel, E., Toniolo, L., Ferry, A., et al. (2013). BMP signaling controls muscle mass. Nat. 
Genet. 45, 1309–18. 
Saucedo, L. J., Gao, X., Chiarelli, D. A., Li, L., Pan, D. and Edgar, B. A. (2003). Rheb 
promotes cell growth as a component of the insulin/TOR signalling network. Nat. Cell Biol. 
5, 566–71. 
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., 
Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source 
platform for biological-image analysis. Nat. Methods 9, 676–82. 
Schmidt-Nielsen, K. (1984). Scaling. Cambridge: Cambridge University Press. 
Schwank, G., Restrepo, S. and Basler, K. (2008). Growth regulation by Dpp: an essential role 
for Brinker and a non-essential role for graded signaling levels. Development 135, 4003–
4013. 
Schwank, G., Dalessi, S., Yang, S.-F., Yagi, R., de Lachapelle, A. M., Affolter, M., Bergmann, 
S. and Basler, K. (2011). Formation of the long range Dpp morphogen gradient. PLoS Biol. 
9, e1001111. 
Sebo, Z. L., Lee, H. B., Peng, Y. and Guo, Y. (2014). A simplified and efficient germline-specific 
CRISPR/Cas9 system for Drosophila genomic engineering. Fly (Austin). 8, 52–7. 
Serpe, M. and O’Connor, M. B. (2006). The metalloprotease tolloid-related and its TGF-beta-like 
substrate Dawdle regulate Drosophila motoneuron axon guidance. Development 133, 
4969–79. 
Setiawan, L., Pan, X., Woods, A. L., O’Connor, M. B. and Hariharan, I. K. (2018). The BMP2/4 
ortholog Dpp can function as an inter-organ signal that regulates developmental timing. Life 
Sci. alliance 1, e201800216. 
Sharma, R. P. and Chopra, V. L. (1976). Effect of the Wingless (wg1) mutation on wing and 
haltere development in Drosophila melanogaster. Dev. Biol. 48, 461–5. 
Shim, K. S. (2015). Pubertal growth and epiphyseal fusion. Ann. Pediatr. Endocrinol. Metab. 20, 
8–12. 
Shimell, M., Pan, X., Martin, F. A., Ghosh, A. C., Leopold, P., O’Connor, M. B. and Romero, 
N. M. (2018). Prothoracicotropic hormone modulates environmental adaptive plasticity 
through the control of developmental timing. Development 145,. 
Shimmi, O., Umulis, D., Othmer, H. and O’Connor, M. B. (2005). Facilitated transport of a 
Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm 
embryo. Cell 120, 873–86. 
Shingleton, A. W. and Frankino, W. A. (2013). New perspectives on the evolution of 
exaggerated traits. Bioessays 35, 100–7. 
Shingleton, A. W., Frankino, W. A., Flatt, T., Nijhout, H. F. and Emlen, D. J. (2007). Size and 
shape: the developmental regulation of static allometry in insects. Bioessays 29, 536–48. 
Shingleton, A. W., Estep, C. M., Driscoll, M. V and Dworkin, I. (2009). Many ways to be small: 
different environmental regulators of size generate distinct scaling relationships in 
Drosophila melanogaster. Proceedings. Biol. Sci. 276, 2625–33. 
  185 
Shlevkov, E. and Morata, G. (2012). A dp53/JNK-dependant feedback amplification loop is 
essential for the apoptotic response to stress in Drosophila. Cell Death Differ. 19, 451–60. 
Siegmund, T. and Korge, G. (2001). Innervation of the ring gland of Drosophila melanogaster. J. 
Comp. Neurol. 431, 481–91. 
Simpson, P. and Schneiderman, H. A. (1975). Isolation of temperature sensitive mutations 
blocking clone development inDrosophila melanogaster, and the effects of a temperature 
sensitive cell lethal mutation on pattern formation in imaginal discs. Wilhelm Roux’s Arch. 
Dev. Biol. 178, 247–275. 
Simpson, P., Berreur, P. and Berreur-Bonnenfant, J. (1980). The initiation of pupariation in 
Drosophila: dependence on growth of the imaginal discs. J. Embryol. Exp. Morphol. 57, 
155–65. 
Song, W., Cheng, D., Hong, S., Sappe, B., Hu, Y., Wei, N., Zhu, C., O’Connor, M. B., Pissios, 
P. and Perrimon, N. (2017a). Midgut-Derived Activin Regulates Glucagon-like Action in the 
Fat Body and Glycemic Control. Cell Metab. 25, 386–399. 
Song, W., Owusu-Ansah, E., Hu, Y., Cheng, D., Ni, X., Zirin, J. and Perrimon, N. (2017b). 
Activin signaling mediates muscle-to-adipose communication in a mitochondria dysfunction-
associated obesity model. Proc. Natl. Acad. Sci. 114, 8596–8601. 
Sopko, R. and Perrimon, N. (2013). Receptor Tyrosine Kinases in Drosophila Development. 
Cold Spring Harb. Perspect. Biol. 5, a009050–a009050. 
Sopory, S., Kwon, S., Wehrli, M. and Christian, J. L. (2010). Regulation of Dpp activity by 
tissue-specific cleavage of an upstream site within the prodomain. Dev. Biol. 346, 102–12. 
Spence, A. J. (2009). Scaling in biology. Curr. Biol. 19, R57-61. 
Spencer, F. A., Hoffmann, F. M. and Gelbart, W. M. (1982). Decapentaplegic: a gene complex 
affecting morphogenesis in Drosophila melanogaster. Cell 28, 451–61. 
Stern, D. L. and Emlen, D. J. (1999). The developmental basis for allometry in insects. 
Development 126, 1091–1101. 
Stieper, B. C., Kupershtok, M., Driscoll, M. V and Shingleton, A. W. (2008). Imaginal discs 
regulate developmental timing in Drosophila melanogaster. Dev. Biol. 321, 18–26. 
Stocker, H., Radimerski, T., Schindelholz, B., Wittwer, F., Belawat, P., Daram, P., Breuer, S., 
Thomas, G. and Hafen, E. (2003). Rheb is an essential regulator of S6K in controlling cell 
growth in Drosophila. Nat. Cell Biol. 5, 559–65. 
Sulkowski, M., Kim, Y.-J. and Serpe, M. (2014). Postsynaptic glutamate receptors regulate local 
BMP signaling at the Drosophila neuromuscular junction. Development 141, 436–47. 
Swarup, S. and Verheyen, E. M. (2012). Wnt/Wingless signaling in Drosophila. Cold Spring 
Harb. Perspect. Biol. 4,. 
Sweeney, S. T. and Davis, G. W. (2002). Unrestricted synaptic growth in spinster-a late 
endosomal protein implicated in TGF-beta-mediated synaptic growth regulation. Neuron 36, 
403–416. 
Tan, P. K., Wang, J., Littler, P.-L. H., Wong, K. K., Sweetnam, T. A., Keefe, W., Nash, N. R., 
Reding, E. C., Piu, F., Brann, M. R., et al. (2007). Monitoring interactions between receptor 
tyrosine kinases and their downstream effector proteins in living cells using bioluminescence 
resonance energy transfer. Mol. Pharmacol. 72, 1440–6. 
Tang, H. Y., Smith-Caldas, M. S. B., Driscoll, M. V, Salhadar, S. and Shingleton, A. W. 
  186 
(2011). FOXO regulates organ-specific phenotypic plasticity in Drosophila. PLoS Genet. 7, 
e1002373. 
Teleman, A. A. (2009). Molecular mechanisms of metabolic regulation by insulin in Drosophila. 
Biochem. J. 425, 13–26. 
Teleman,  a a and Cohen, S. M. (2000). Dpp gradient formation in the Drosophila wing imaginal 
disc. Cell 103, 971–80. 
Thomas, H. E., Stunnenberg, H. G. and Stewart, A. F. (1993). Heterodimerization of the 
Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362, 471–5. 
Ting, C.-Y., Herman, T., Yonekura, S., Gao, S., Wang, J., Serpe, M., O’Connor, M. B., 
Zipursky, S. L. and Lee, C.-H. (2007). Tiling of r7 axons in the Drosophila visual system is 
mediated both by transduction of an activin signal to the nucleus and by mutual repulsion. 
Neuron 56, 793–806. 
Ting, C.-Y., McQueen, P. G., Pandya, N., Lin, T.-Y., Yang, M., Reddy, O. V., O’Connor, M. B., 
McAuliffe, M. and Lee, C.-H. (2014). Photoreceptor-derived activin promotes dendritic 
termination and restricts the receptive fields of first-order interneurons in Drosophila. Neuron 
81, 830–846. 
Trendelenburg, A. U., Meyer, A., Rohner, D., Boyle, J., Hatakeyama, S. and Glass, D. J. 
(2009). Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation 
and myotube size. Am. J. Physiol. Cell Physiol. 296, C1258-70. 
Tsuneizumi, K., Nakayama, T., Kamoshida, Y., Kornberg, T. B., Christian, J. L. and Tabata, 
T. (1997). Daughters against dpp modulates dpp organizing activity in Drosophila wing 
development. Nature 389, 627–31. 
Tuck, S. (2014). The control of cell growth and body size in Caenorhabditis elegans. Exp. Cell 
Res. 321, 71–6. 
Twitty, V. C. and Schwind, J. L. (1931). The growth of eyes and limbs transplanted 
heteroplastically between two species of Amblystoma. J. Exp. Zool. 59, 61–86. 
Upadhyay, A., Moss-Taylor, L., Kim, M., Ghosh, A. C. and O’Connor, M. B. (2017). TGF-β 
Family Signaling in Drosophila. Cold Spring Harb. Perspect. Biol. 9,. 
Uyehara, C. M. and McKay, D. J. (2019). Direct and widespread role for the nuclear receptor 
EcR in mediating the response to ecdysone in Drosophila. Proc. Natl. Acad. Sci. 
201900343. 
Vuilleumier, R., Springhorn, A., Patterson, L., Koidl, S., Hammerschmidt, M., Affolter, M. 
and Pyrowolakis, G. (2010). Control of Dpp morphogen signalling by a secreted feedback 
regulator. Nat. Publ. Gr. 12, 611–617. 
Wang, S., Tsun, Z.-Y., Wolfson, R. L., Shen, K., Wyant, G. A., Plovanich, M. E., Yuan, E. D., 
Jones, T. D., Chantranupong, L., Comb, W., et al. (2015). The amino acid transporter 
SLC38A9 is a key component of a lysosomal membrane complex that signals arginine 
sufficiency to mTORC1. Science 347, 188–94. 
Wartlick, O., Mumcu, P., Kicheva,  a, Bittig, T., Seum, C., Jülicher, F. and González-Gaitán, 
M. (2011a). Dynamics of Dpp signaling and proliferation control. Science 331, 1154–1159. 
Wartlick, O., Mumcu, P., Jülicher, F. and González-Gaitán, M. (2011b). Understanding 
morphogenetic growth control -- lessons from flies. Nat. Rev. Mol. Cell Biol. 12, 594–604. 
Weiss, A., Charbonnier, E., Ellertsdóttir, E., Tsirigos, A., Wolf, C., Schuh, R., Pyrowolakis, 
G. and Affolter, M. (2010). A conserved activation element in BMP signaling during 
  187 
Drosophila development. Nat. Struct. Mol. Biol. 17, 69–76. 
Williams, E. K., Chang, R. B., Strochlic, D. E., Umans, B. D., Lowell, B. B. and Liberles, S. D. 
(2016). Sensory Neurons that Detect Stretch and Nutrients in the Digestive System. Cell 
166, 209–221. 
Willsey, H. R., Zheng, X., Carlos Pastor-Pareja, J., Willsey, A. J., Beachy, P. A. and Xu, T. 
(2016). Localized JNK signaling regulates organ size during development. Elife 5,. 
Winbanks, C. E., Chen, J. L., Qian, H., Liu, Y., Bernardo, B. C., Beyer, C., Watt, K. I., 
Thomson, R. E., Connor, T., Turner, B. J., et al. (2013). The bone morphogenetic protein 
axis is a positive regulator of skeletal muscle mass. J. Cell Biol. 203, 345–57. 
Wolfman, N. M., McPherron, A. C., Pappano, W. N., Davies, M. V, Song, K., Tomkinson, K. 
N., Wright, J. F., Zhao, L., Sebald, S. M., Greenspan, D. S., et al. (2003). Activation of 
latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proc. Natl. Acad. Sci. U. 
S. A. 100, 15842–6. 
Wolfson, R. L. and Sabatini, D. M. (2017). The Dawn of the Age of Amino Acid Sensors for the 
mTORC1 Pathway. Cell Metab. 26, 301–309. 
Wolfson, R. L., Chantranupong, L., Saxton, R. A., Shen, K., Scaria, S. M., Cantor, J. R. and 
Sabatini, D. M. (2016). Sestrin2 is a leucine sensor for the mTORC1 pathway. Science 351, 
43–8. 
Wood, A. R., Esko, T., Yang, J., Vedantam, S., Pers, T. H., Gustafsson, S., Chu, A. Y., 
Estrada, K., Luan, J., Kutalik, Z., et al. (2014). Defining the role of common variation in the 
genomic and biological architecture of adult human height. Nat. Genet. 46, 1173–86. 
Wu, Q., Wen, T., Lee, G., Park, J. H., Cai, H. N. and Shen, P. (2003a). Developmental control of 
foraging and social behavior by the Drosophila neuropeptide Y-like system. Neuron 39, 
147–61. 
Wu, S., Huang, J., Dong, J. and Pan, D. (2003b). hippo encodes a Ste-20 family protein kinase 
that restricts cell proliferation and promotes apoptosis in conjunction with salvador and 
warts. Cell 114, 445–56. 
Wu, Q., Zhang, Y., Xu, J. and Shen, P. (2005). Regulation of hunger-driven behaviors by neural 
ribosomal S6 kinase in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 102, 13289–94. 
Wyant, G. A., Abu-Remaileh, M., Wolfson, R. L., Chen, W. W., Freinkman, E., Danai, L. V, 
Vander Heiden, M. G. and Sabatini, D. M. (2017). mTORC1 Activator SLC38A9 Is 
Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient. 
Cell 171, 642-654.e12. 
Yamanaka, N., Rewitz, K. F. and O’Connor, M. B. (2013a). Ecdysone control of developmental 
transitions: lessons from Drosophila research. Annu. Rev. Entomol. 58, 497–516. 
Yamanaka, N., Romero, N. M., Martin, F. A., Rewitz, K. F., Sun, M., O’Connor, M. B. and 
Léopold, P. (2013b). Neuroendocrine control of Drosophila larval light preference. Science 
341, 1113–6. 
Yao, T. P., Forman, B. M., Jiang, Z., Cherbas, L., Chen, J. D., McKeown, M., Cherbas, P. and 
Evans, R. M. (1993). Functional ecdysone receptor is the product of EcR and Ultraspiracle 
genes. Nature 366, 476–9. 
Yu, X. M., Gutman, I., Mosca, T. J., Iram, T., Ozkan, E., Garcia, K. C., Luo, L. and Schuldiner, 
O. (2013). Plum, an immunoglobulin superfamily protein, regulates axon pruning by 
facilitating TGF-β signaling. Neuron 78, 456–68. 
  188 
Zagorodnyuk, V. P., Chen, B. N. and Brookes, S. J. (2001). Intraganglionic laminar endings are 
mechano-transduction sites of vagal tension receptors in the guinea-pig stomach. J. Physiol. 
534, 255–68. 
Zamani, N. and Brown, C. W. (2011). Emerging roles for the Transforming Growth Factor-
β  superfamily in regulating adiposity and energy expenditure. Endocr. Rev. 32, 387–403. 
Zecca, M. and Struhl, G. (2002). Control of growth and patterning of the Drosophila wing 
imaginal disc by EGFR-mediated signaling. Development 129, 1369–76. 
Zecca, M., Basler, K. and Struhl, G. (1995). Sequential organizing activities of engrailed, 
hedgehog and decapentaplegic in the Drosophila wing. Development 121, 2265–78. 
Zheng, X., Wang, J., Haerry, T. E., Wu, A. Y.-H., Martin, J., O’Connor, M. B., Lee, C.-H. J. and 
Lee, T. (2003). TGF-beta signaling activates steroid hormone receptor expression during 
neuronal remodeling in the Drosophila brain. Cell 112, 303–315. 
Zhou, X., Wang, J. L., Lu, J., Song, Y., Kwak, K. S., Jiao, Q., Rosenfeld, R., Chen, Q., Boone, 
T., Simonet, W. S., et al. (2010). Reversal of cancer cachexia and muscle wasting by 
ActRIIB antagonism leads to prolonged survival. Cell 142, 531–43. 
Zhou, S., Lo, W.-C., Suhalim, J. L., Digman, M. a, Gratton, E., Nie, Q. and Lander, A. D. 
(2012). Free extracellular diffusion creates the Dpp morphogen gradient of the Drosophila 
wing disc. Curr. Biol. 22, 668–75. 
Zhu, C. C., Boone, J. Q., Jensen, P. A., Hanna, S., Podemski, L., Locke, J., Doe, C. Q. and 
O’Connor, M. B. (2008). Drosophila Activin- and the Activin-like product Dawdle function 
redundantly to regulate proliferation in the larval brain. Development 135, 513–521.